Previous Contig 001932:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045G01Sequence543001932 (7)pir|A86413|A864132e-18probable ribosomal protein L34 [imported] - Arabidopsis thaliana>gb:AE005172_891553001932 (7)pir|A86413|A864132e-18probable ribosomal protein L34 [imported] - Arabidopsis thaliana>gb:AE005172_891
JMFN025I19Sequence571001932 (7)pir|A86413|A864135e-19probable ribosomal protein L34 [imported] - Arabidopsis thaliana>gb:AE005172_891
JMFN030E14Sequence315001932 (7)gb:AP003232_18258270.024Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003
JMFN039G23Sequence623001932 (7)pir|A86413|A864136e-19probable ribosomal protein L34 [imported] - Arabidopsis thaliana>gb:AE005172_891
JMSF053K13Sequence584001932 (7)pir|A86413|A864135e-19probable ribosomal protein L34 [imported] - Arabidopsis thaliana>gb:AE005172_891544001932 (7)pir|A86413|A864135e-19probable ribosomal protein L34 [imported] - Arabidopsis thaliana>gb:AE005172_891

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045G01- CCTTATGGCGGATCACCCTGGAGAGCTTTTTTTTTT
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGCTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF045G01- TTTTCTTTTTTTTTTTTTTAATCAAATTATGCAATGCATGCAAAAAGAAAGATCTCACCA
JMFN039G23+ CACCA
                      ____________________________________________________________
consensus TTTTCTTTTTTTTTTTTTTAATCAAATTATGCAATGCATGCAAAAAGAAAGATCTCACCA
 
. : . : . : . : . : . :
rJMFF045G01- GAACAAAGAATGCAAATTAGATGTGTGAATAAAACCATCAAACACACTGATAAGAAACTG
JMSF053K13+ TGTGAATAAAACCATCAAACACACTGATAAGAAACTG
JMFN039G23+ GAACAAAGAATGCAAATTAGATGTGTGAATAAAACCATCAAACACACTGATAAGAAACTG
                      ____________________________________________________________
consensus GAACAAAGAATGCAAATTAGATGTGTGAATAAAACCATCAAACACACTGATAAGAAACTG
 
. : . : . : . : . : . :
rJMFF045G01- CAAGTAGTCTCAAAAAGGACTGCATTTACCTACAACAAACAGCATACATGCCAAAAACAC
rJMSF053K13- AGTAGTCTCAGAAAGGACTGCATTTACCTACAACAAACAGCATACATGCCAAAAACAC
JMSF053K13+ CAAGTAGTCTCAGAAAGGACTGCATTTACCTACAACAAACAGCATACATGCCAAAAACAC
JMFN039G23+ CAAGTAGTCTCAGAAAGGACTGCATTTACCTACAACAAACAGCATACATGCCAAGAACGC
JMFN025I19+ AGTCTCAGAAAGGACTGCATTTACCTACAACAAACAGCATACATGCCAAAAACAC
JMFF045G01+ CAC
                      ____________________________________________________________
consensus CAAGTAGTCTCAGAAAGGACTGCATTTACCTACAACAAACAGCATACATGCCAAAAACAC
 
. : . : . : . : . : . :
rJMFF045G01- AAAGGATCAAGCCCGTTTCCCACTATACGGGTTGGTCTTGGTGCAAAGATTATGTCGACC
rJMSF053K13- AAAGGATCAAGCCCGTTTCCCACTATACGGGTTGGTCTTGGTGCAGAGATTATGTCGACC
JMSF053K13+ AAAGGATCAAGCCCGTTTCCCACTATACGGGTTGGTCTTGGTGCAGAGATTATGTCGACC
JMFN039G23+ AAAGGATCAAGCCCGTTTCCCACTATACGGGTTGGTCTTGGTGCAGAGATTATGTCGACC
JMFN025I19+ AAAGGATCAAGCCCGTTTCCCACTATACGGGTTGGTCTTGGTACAGAGATTATGTCGACC
JMFF045G01+ AAAGGATCAAGCCCGTTTCCCGCTATACGGGGTGGTCTTGGTGCAGAGATTATGTCGACC
                      ____________________________________________________________
consensus AAAGGATCAAGCCCGTTTCCCACTATACGGGTTGGTCTTGGTGCAGAGATTATGTCGACC
 
. : . : . : . : . : . :
rJMFF045G01- CTTGGCCCGTCTTCGCTTCAAAAGTGCTCTTCCACTCGTGGTGCGCATGCGCCTACGGAA
rJMSF053K13- CTTGGCCCGTCTTCGCTTCAAAAGTGCTCTTCCACTCGTGGTGCGCATGCGCCTACGGAA
JMSF053K13+ CTTGGCCCGTCTTCGCTTCAAAAGTGCTCTTCCACTCGTGGTGCGCATGCGCCTACGGAA
JMFN039G23+ CTTGGCCCGTCTTCGCTTCAAAAGTGCTCTTCCACTCGTGGTGCGCATGCGCCTACGGAA
JMFN025I19+ CTTGGCCCGTCTTCGCTTCAAAAGTGCTCTTCCACTCGTGGTGCGCATGCGCCTACGGAA
JMFF045G01+ CTTGGCCCGTCTTCGCTTCAAAAGTGCTCTTCCACTCGTGGTGCGCATGCGCCTACGGAA
                      ____________________________________________________________
consensus CTTGGCCCGTCTTCGCTTCAAAAGTGCTCTTCCACTCGTGGTGCGCATGCGCCTACGGAA
 
. : . : . : . : . : . :
rJMFF045G01- GCCATGTGTTCGGGCTAACGACTTCCTAAACCTACTCCTCTTGGTTTGACAAAGAGCAGC
rJMSF053K13- GCCATGTGTTCGGGCTAACGACTTCCTAGACCTACTCCTCTTGGTTTGACAAAGAGCAGC
JMSF053K13+ GCCATGTGTTCGGGCTAACGACTTCCTAGACCTACTCCTCTTGGTTTGACAAAGAGCAGC
JMFN039G23+ GCCATGTGTTCGGGCTAACGACTTCCTAGACCTACTCCTCTTGGTTTGACAAAGAGCAGC
JMFN025I19+ GCCATGTGTTCGGGCTAACGACTTCCTAGACCTACTCCTCTTGGTTTGACAAAGAGCAGC
JMFN030E14+ ACTCCTCTTGGTTTGACAAAGGGCAGC
JMFF045G01+ GCCATGTGTTCGGGCTAACGACTTCCTAGACCTACTCCTCTTGGTTTGACAAAGAGCAGC
                      ____________________________________________________________
consensus GCCATGTGTTCGGGCTAACGACTTCCTAGACCTACTCCTCTTGGTTTGACAAAGAGCAGC
 
. : . : . : . : . : . :
rJMFF045G01- TTTCCCTGCTCTAACCACCAAAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
rJMSF053K13- TTTCCCTGCTCTAACCACCAGAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
JMSF053K13+ TTTCCCTGCTCTAACCACCAGAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
JMFN039G23+ TTTCCCTGCTCTAACCACCAGAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
JMFN025I19+ TTTCCCTGCTCTAACCACCAGAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
JMFN030E14+ TTTCCCTGCTCTAACCACCAGAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
JMFF045G01+ TTTCCCTGCTCTAACCACCAGAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
                      ____________________________________________________________
consensus TTTCCCTGCTCTAACCACCAGAACACGCCTTCTACCCGTGCTCACTCCACTGTTAATATT
 
. : . : . : . : . : . :
rJMFF045G01- GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGAACTAGAAATGCTAGAGAGCGGTGA
rJMSF053K13- GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGAACTAGAAATGCTAGAGAGCGGTGA
JMSF053K13+ GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGAACTAGAAATGCTAGAGAGCGGTGA
JMFN039G23+ GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGAACTAGAAATGCTAGAGAGCGGTGA
JMFN025I19+ GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGAACTAGAAATGCTAGAGAGCGGTGA
JMFN030E14+ GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGATCTAGAAATGCTAGAGAGCGGTGA
JMFF045G01+ GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGAACTAGAAATGCTAGAGAGCGGTGA
                      ____________________________________________________________
consensus GAAGCTCAACCCCAGTGATGAACCTGAGAAGGAGGAACTAGAAATGCTAGAGAGCGGTGA
 
. : . : . : . : . : . :
rJMFF045G01- AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGA
rJMSF053K13- AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGAGCTGTGGATTTGAGAGAGACCGA
JMSF053K13+ AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGAGCTGTGGATTTGAGAGAGACCGA
JMFN039G23+ AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGAGCTGTGGATTTGAGAGAGACCGA
JMFN025I19+ AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGAGCTGTGGATTTGAGAGAGACCGA
JMFN030E14+ AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGAGCTGTGGATTTGAGAGAGACCGA
JMFF045G01+ AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGAGCTGTGGATTTGAGAGAGACCGA
                      ____________________________________________________________
consensus AGAAGCAGAGACAAAGGAGCAGCGAAGGAAGCCAGGAGCTGTGGATTTGAGAGAGACCGA
 
. : . : . : . : . : . :
rJMSF053K13- GGCGGGTGTAGTAGCTCTTGAAGCGGCGGCGAGCGACAGAGAAGCCGAGGTTGCCGGCCT
JMSF053K13+ GGCGGGTGTAGTAGCTCTTGAAGCGGCGGCGAGCGACAGAGAAGCCGAGGTTGCCGGCCT
JMFN039G23+ GGCGGGTGTAGTAGCTCTTGAAGCGGCGGCGAGCGACAGAGAAGCCGAGGTTGCCGGCCT
JMFN025I19+ GGCGGGTGTAGTAGCTCTTGAAGCGGCGGCGAGCGACAGAGAAGCCGAGGTTGCCGGCCT
JMFN030E14+ GGCGGGTGTAGTAGCTCTTGAAGCGGCGGCGAGCGACAGAGAAGCCGAGGTTGCCGGCCT
JMFF045G01+ GGCGGGTGTAGTAGCTCTTGAAGCGGCGGCGAGCGACAGAGAAGCCGAGGTTGCCGGCCT
                      ____________________________________________________________
consensus GGCGGGTGTAGTAGCTCTTGAAGCGGCGGCGAGCGACAGAGAAGCCGAGGTTGCCGGCCT
 
. : . : . : . : . : . :
rJMSF053K13- TTGTCGGACGCCTGTGCAGAGCCACGTTCCTGTTGCAACAGCAGCCATTGTTTC
JMSF053K13+ TTGTCGGACGCCTGTGCAGAGCCACGTTCCTGTTGCAACAGCAGCCATTGTTTC
JMFN039G23+ TTGTCGGACGCCGGTGCAGAGCCACGTTCCTGTTGCAACAGCAGCCATTG-TTCACCTCT
JMFN025I19+ TTGTCGGACGCCTGTGCAGAGCCACGTTCCTGTTGCAACAGCAGCCATTGTTTCACCTCT
JMFN030E14+ TTGTCGGAGTCCTGTGCAGAGCCACGTTCCTG-TGCAACAGCAGCCAT
JMFF045G01+ TTGTCGGACGCCTGTGCAGAGCCACGTTCCTGTTGCAACAGCAGCCATTGTTTCACCTCT
                      ____________________________________________________________
consensus TTGTCGGACGCCTGTGCAGAGCCACGTTCCTGTTGCAACAGCAGCCATTGTTTCACCTCT
 
. : . : . : . : . : . :
JMFN039G23+ CTTCCTATCTACAAACCAA
JMFN025I19+ CTTCCTATCTACAAACCAAGTTTAAGGCTTTGGCTC
JMFF045G01+ CTTCCTATCTACAAACCAAGTTTAAGGCTTTGGCTCTTTGCAGCCTTATCGGATAAGCTT
                      ____________________________________________________________
consensus CTTCCTATCTACAAACCAAGTTTAAGGCTTTGGCTCTTTGCAGCCTTATCGGATAAGCTT