Previous Contig 001930:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045F16Sequence660001930 (5)gb:BT002888_16364792e-17Arabidopsis thaliana clone RAFL14-84-K20 (R20388) unknown protein (At3g03880) mR609001930 (5)gb:BT012600_16416703e-35Arabidopsis thaliana At1g55340 gene, complete cds.>gb:BT014840_1641830 Arabidops
JMFF051F17Sequence600001930 (5)gb:BT002888_16364796e-10Arabidopsis thaliana clone RAFL14-84-K20 (R20388) unknown protein (At3g03880) mR571001930 (5)gb:BT012600_16416702e-35Arabidopsis thaliana At1g55340 gene, complete cds.>gb:BT014840_1641830 Arabidops
JMFN010N14Sequence626001930 (5)gb:BT002888_16364791e-19Arabidopsis thaliana clone RAFL14-84-K20 (R20388) unknown protein (At3g03880) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045F16- GCACAACATCAATCTAT
                      ____________________________________________________________
consensus GCACAACATCAATCTAT
 
. : . : . : . : . : . :
rJMFF045F16- GGTCTCTTATTGGCCCCATTGGAACACCGAACAGAAGAAAAATTGCACGAAATTAATATG
rJMFF051F17- ACGAAATTAATATG
                      ____________________________________________________________
consensus GGTCTCTTATTGGCCCCATTGGAACACCGAACAGAAGAAAAATTGCACGAAATTAATATG
 
. : . : . : . : . : . :
rJMFF045F16- AATTTGCTGCGCAATACAAAATGAAATTACAGTTTGGGTTTGACTGACGGACATAATCGG
rJMFF051F17- AATTTGCTGCGCAATACAAAATGAAATTACAGTTTGGGTTTGACTGACGGACATAATCGG
                      ____________________________________________________________
consensus AATTTGCTGCGCAATACAAAATGAAATTACAGTTTGGGTTTGACTGACGGACATAATCGG
 
. : . : . : . : . : . :
rJMFF045F16- AACAAATTTACAAGTGAACCAATTCTGCTACCATCCCTTTTAACTACCCCCTAATTCAAT
rJMFF051F17- AACAAATTTACAAGTGAACCAATTCTGCTACCATCCCTTTTAACTACCCCCTAATTCAAT
                      ____________________________________________________________
consensus AACAAATTTACAAGTGAACCAATTCTGCTACCATCCCTTTTAACTACCCCCTAATTCAAT
 
. : . : . : . : . : . :
rJMFF045F16- CATTTCCGTAACGGAAAAAAATATATAACAGACAAAGTTGGGGAAAATCCTGACTCCGTT
rJMFF051F17- CATTTCCGTAACGGAAAAAAATATATAACAGACAAAGTTGGGGAAAATCCTGACTCCGTT
                      ____________________________________________________________
consensus CATTTCCGTAACGGAAAAAAATATATAACAGACAAAGTTGGGGAAAATCCTGACTCCGTT
 
. : . : . : . : . : . :
rJMFF045F16- AGTCCTTTCATTCTGAATCACTTTCCACGCTGCCCATTGCCTTTAATCCTCTGGCTCTCT
rJMFF051F17- AGTCCTTTCGCTCTGAATCACTTTCCACGCTGCCCATTGCCTTTAATCCTCTGGCTCTCT
                      ____________________________________________________________
consensus AGTCCTTTCGTTCTGAATCACTTTCCACGCTGCCCATTGCCTTTAATCCTCTGGCTCTCT
 
. : . : . : . : . : . :
rJMFF045F16- TCTTAGTACTCTTCTTCTCTCTGACTTCATACCTCTCTAAAGACATGTCGGTTAACCATG
rJMFF051F17- TCTTAGTACTCTTCTTCTCTCTGACTTCATACCTCTCTAAAGACATGTCGGTTAACCATG
                      ____________________________________________________________
consensus TCTTAGTACTCTTCTTCTCTCTGACTTCATACCTCTCTAAAGACATGTCGGTTAACCATG
 
. : . : . : . : . : . :
rJMFF045F16- CTCCCGGACTCACCAAAAGCAAAGTTCTTTGGATGACTTTAGCCCTCTTCTTAGGTCTTT
rJMFF051F17- CTCCCGGACTCACCAAAAGCAAAGTTCTTTGGATGACTTTAGCCCTCTTCTTAGGTCTTT
                      ____________________________________________________________
consensus CTCCCGGACTCACCAAAAGCAAAGTTCTTTGGATGACTTTAGCCCTCTTCTTAGGTCTTT
 
. : . : . : . : . : . :
rJMFF045F16- GAGGAAGCTTACACCCTTTCATGGCCATGAAATCCTCTT-CCTTTTCCTTGCTTGACAAC
rJMFF051F17- GAGGAAGCTTACACCCTTTCATGGCCATGAAATCCTCTT-CCTTTTCCTTGCTTGACAAC
JMFN010N14+ AAGCTTACACCCTTTCATGGCCATGAAATCCTCTT-CCTTTTCCTTGCTTGACAAC
JMFF045F16+ AAGCTTACACCCTTTCATGGCCATG-AATCCTCTTCCCTTTTCCTTGCTTGACAAC
                      ____________________________________________________________
consensus GAGGAAGCTTACACCCTTTCATGGCCATGAAATCCTCTT-CCTTTTCCTTGCTTGACAAC
 
. : . : . : . : . : . :
rJMFF045F16- GATATATACAGCTTCGGCCAAACCACCCCTCCTCCTCCTCTATTGCTGTCGTCTCCGGCG
rJMFF051F17- GATATATACAGCTTCGGCCAAACCACCCCTCCTCCTCCTCTATTGCTGTCGTCTCCGGCG
JMFN010N14+ GATATATACAGCTTCGGCCAAACCACCCCTCCTCCTCCTCTATTGCTGTCGTCTCCGGCG
JMFF051F17+ GATATATACAGCTTCGGCCAACCCACCCCTCCTCCTCCTCTATTGCTGTCGTCTCCGGCG
JMFF045F16+ GATATATACAGCTTCGGCCAAACCACCCCTCCTCCTCCTCTATTGCTGTCGTCTCCGGCG
                      ____________________________________________________________
consensus GATATATACAGCTTCGGCCAAACCACCCCTCCTCCTCCTCTATTGCTGTCGTCTCCGGCG
 
. : . : . : . : . : . :
rJMFF045F16- TGATTTCCCCCGCCGGCGTCCGCCGCTGCAACCTTCCCATTTTCCTCCGCCGA
rJMFF051F17- TGATTTCCCCCGCCAGCGTCCGCCGCNTGCACCTTCCCATTTTCCTCCGCCGACCCTCTC
JMFN010N14+ TGATTTCCCCCGCCGGCGTCCGCCGCTGCAACCTTCCCATTTTCCTCCGCCGACCCTCTC
JMFF051F17+ TGATTTCCCCCGCCAGCGTCCGCCGCTGCAACCTTCCCATTTTCCTCCGCCGACCCTCTC
JMFF045F16+ TGATTTCCCCCGCCGGCGTCCGCCGCTGCAACCTTCCCATTTTCCTCCGCCGACCCTCTC
                      ____________________________________________________________
consensus TGATTTCCCCCGCCGGCGTCCGCCGCTGCAACCTTCCCATTTTCCTCCGCCGACCCTCTC
 
. : . : . : . : . : . :
rJMFF051F17- GTCGGGTA
JMFN010N14+ GTCGGGTAACACCGTTCCTCCTTCTCCGGCGACCTCGACGCACTCCTCCGGTTCTCCGAT
JMFF051F17+ GTCGGGTAACACCGTTCCTCCTTCTCCGGCGACCTCGACGCACTCCTCCGGTTCTCCGAT
JMFF045F16+ GTCGGGTAACACCGTTCCTCCTTCTCCGGCGACCTCGACGCACTCCTCCGGTTCTCCGAT
                      ____________________________________________________________
consensus GTCGGGTAACACCGTTCCTCCTTCTCCGGCGACCTCGACGCACTCCTCCGGTTCTCCGAT
 
. : . : . : . : . : . :
JMFN010N14+ CTCAACGCCGCCGTCTCAGAATTCCTGGTGTGGCGTGGCGGGAGAAAAGCGGCGTCTTTG
JMFF051F17+ CTCAACGCCGCCGTCTCAGAATTCCTGGTGTGGCGTGGCGGGAGAAAAGCGGCGTCTTTG
JMFF045F16+ CTCAACGCCGCCGTCTCAGAATTCCTGGTGTGGCGTGGCGGGAGAAAAGCGGCGTCTTTG
                      ____________________________________________________________
consensus CTCAACGCCGCCGTCTCAGAATTCCTGGTGTGGCGTGGCGGGAGAAAAGCGGCGTCTTTG
 
. : . : . : . : . : . :
JMFN010N14+ GCGGAGAGGGTGAGGAAGCGAGACGAGATTTTCCGGCGAAGCCTGGTGGCGTTTGAAGAA
JMFF051F17+ GCGGAGAGGGTGAGGAAGCGAGACGAGATTTTCCGGCGAAGCCTGGTGGCGTCTGAAGAA
JMFF045F16+ GCGGAGAGGGTGAGGAAGCGAGACGAGATTTTCCGGCGAAGCCTGGTGGCGTCTGAAGAA
                      ____________________________________________________________
consensus GCGGAGAGGGTGAGGAAGCGAGACGAGATTTTCCGGCGAAGCCTGGTGGCGTCTGAAGAA
 
. : . : . : . : . : . :
JMFN010N14+ GAAGGGTCAGGGCCTCTAACTCTCACACATCGGAGTCTCTTTCTGCTCCCCCACTGTAAG
JMFF051F17+ GAAGGGTCAGGGCCTCTAACTCTCACACATCGGAGTCTCTTTCTGCTCCCCCACTGTAAG
JMFF045F16+ GAAGGGTCAGGGCCTCTAACTCTCACACATCGGAGTCTCTTTCTGCTCCCCCACTGTAAG
                      ____________________________________________________________
consensus GAAGGGTCAGGGCCTCTAACTCTCACACATCGGAGTCTCTTTCTGCTCCCCCACTGTAAG
 
. : . : . : . : . : . :
JMFN010N14+ AAATACTCCGTTTCCGCCGCTCTCGGGTTCTTGCCTTCCTTCTCCATCCCTCAATTCATA
JMFF051F17+ AAATACTCCGTTTCCGCCGCTCTCGGGTTCTTGCCTTCCTTCTCCATCCCTCAATTCATA
JMFF045F16+ AAATACTCCGTTTCCGCCGCTCTCGGGTTCTTGCCTTCCTTCTCCATCCCTCAATTCATA
                      ____________________________________________________________
consensus AAATACTCCGTTTCCGCCGCTCTCGGGTTCTTGCCTTCCTTCTCCATCCCTCAATTCATA
 
. : . : . : . : . : . :
JMFN010N14+ TAATCCTGAAACCCAAAAAAAATCCCAGAAATGTTGAAATTATCCTCAAATGACAGGAAA
JMFF051F17+ TAATCCTGAAACCCAAAAAAAATCCCAGAAATGTTGAAATTATCCTCAAATGACAGGAAA
JMFF045F16+ TAATCCTGAAACCCAAAAAAAATCCCAGAAATGTTGAAATTATCCTCAAATGACAGGAAA
                      ____________________________________________________________
consensus TAATCCTGAAACCCAAAAAAAATCCCAGAAATGTTGAAATTATCCTCAAATGACAGGAAA
 
. : . : . : . : . : . :
JMFN010N14+ CCCAGATTCTGGATTATGAAGGAAACCTCCGATTATCTATGAAATTGAAGATTTTGAAGG
JMFF051F17+ CCCAGATTCTGGATTATGAAGGAAACCTCCGATTATCTATGAAATTGAAGATTTTGAAGG
JMFF045F16+ CCCAGATTCTGGATTATGAAGGAAACCTCCGATTATCTATGAAATTGAAGATTTTGAAGG
                      ____________________________________________________________
consensus CCCAGATTCTGGATTATGAAGGAAACCTCCGATTATCTATGAAATTGAAGATTTTGAAGG
 
. : . : . : . : . : . :
JMFN010N14+ TGGG--GTGTGTGTGTTCTGTTTCTCTGCTTCT
JMFF051F17+ TGGGGTGTGTGTGTGTTCTGTTTCTCTGCTTCTTCTCTGCCTCTGTTTGCTCTTTTCCGG
JMFF045F16+ TGGGGTGTGTGTGTGTTCTGTTTCTCTGCTTCTTCTCTGCCTCTGTTTGCTCTTTTCCGG
                      ____________________________________________________________
consensus TGGGGTGTGTGTGTGTTCTGTTTCTCTGCTTCTTCTCTGCCTCTGTTTGCTCTTTTCCGG