Previous Contig 001925:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028M05Sequence441001925 (4)681010518 (3)gb:AP003523_18303663e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P041
JMFF038N10Sequence315001925 (4)746010518 (3)gb:AP003523_18303663e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P041
JMFF045E19Sequence632001925 (4)580010518 (3)gb:AP003523_18303662e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P041
JMFS112C06Sequence644001925 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS112C06+ GGAGATCCTGCTGACGACGGCGACGATGACGGCAAATCCTCGAAGATGCTTGATC
JMFF045E19+ GACGATGACGGCAAATCCTCGAAGATGCTTGATC
                      ____________________________________________________________
consensus GGAGATCCTGCTGACGACGGCGACGATGACGGCAAATCCTCGAAGATGCTTGATC
 
. : . : . : . : . : . :
JMFS112C06+ TCTTGCCGCACACTATGGCAGACATGTTGTGGATATTCCACCACGACAAAACCTTCACAA
JMFF045E19+ TCTTGCCGCACACTATGGCAGACATGTTGTGGATATTCCACCACGACAAAACCTTCACAA
                      ____________________________________________________________
consensus TCTTGCCGCACACTATGGCAGACATGTTGTGGATATTCCACCACGACAAAACCTTCACAA
 
. : . : . : . : . : . :
JMFS112C06+ CAACAACAATTCCTCACTCGCCGTTCCACCGCTCATGCAGATCAAATCGCACACCAATTC
JMFF045E19+ CAACAACAATTCCTCACTCGCCGTTCCACCGCTCATGCAGATCAAATCGCACACCAATTC
                      ____________________________________________________________
consensus CAACAACAATTCCTCACTCGCCGTTCCACCGCTCATGCAGATCAAATCGCACACCAATTC
 
. : . : . : . : . : . :
JMFS112C06+ GGACACAGCAAAAAAAAAAAATCCAAGATCCGATCAATCAATCCATCAATTAATCAATCC
JMFF028M05+ AAAAAAAAAAATCCAAGATCCGATCAATCAATCCATCAATTAATCAATCC
JMFF038N10+ AAAAAAAAAAATCCAAGATCCGATCAATCAATCCATCAATTAATCAATCC
JMFF045E19+ GGACACAGC-AAAAAAAAAAATCCAAGATCCGATCAATCAATCCATCAATTAATCAATCC
                      ____________________________________________________________
consensus GGACACAGCAAAAAAAAAAAATCCAAGATCCGATCAATCAATCCATCAATTAATCAATCC
 
. : . : . : . : . : . :
JMFS112C06+ AAACTCGCAACCACACCCAACAACCACCGACGAATTCCCAATTCCAATCAAACTACAACT
JMFF028M05+ AAACTCGCAACCACACCCAACAACCACCGACGAATTCCCAATTCCAATCAAACTACAACT
JMFF038N10+ AAACTCGCAACCACACCCAACAACCACCGACGAATTCCCAATTCCAATCAAACTACAACT
JMFF045E19+ AAACTCGCAACCACACCCAACAACCACCGACGAATTCCCAATTCCAATCAAACTACAACT
                      ____________________________________________________________
consensus AAACTCGCAACCACACCCAACAACCACCGACGAATTCCCAATTCCAATCAAACTACAACT
 
. : . : . : . : . : . :
JMFS112C06+ ATCAATCTATCTATCTATTAACAAACATATACACAAACACACGCATACGTGATTACGTAT
JMFF028M05+ ATCAATCTATCTATCTATTAACAAACATATACACAAACACACGCATACGTGATTACGTAT
JMFF038N10+ ATCAATCTATCTATCTATTAACAAACATATACACAAACACACGCATACGTGATTACGTAT
JMFF045E19+ ATCAATCTATCTATCTATTAACAAACATATACACAAACACACGCATACGTGATTACGTAT
                      ____________________________________________________________
consensus ATCAATCTATCTATCTATTAACAAACATATACACAAACACACGCATACGTGATTACGTAT
 
. : . : . : . : . : . :
JMFS112C06+ ACACCGACCAAATCCACAACGACTATTGATTTCTCTCTACGATTGAGAATGAAAAGAGAG
JMFF028M05+ ACACCGACCAAATCCACAACGACTATTGATTTCTCTCTACGATTGAGAATGAAAAGAGAG
JMFF038N10+ ACACCGACCAAATCCACAACGACTATTGATTTCTCTCTACGATTGAGAAT
JMFF045E19+ ACACCGACCAAATCCACAACGACTATTGATTTCTCTCTACGATTGAGAATGAAAAGAGAG
                      ____________________________________________________________
consensus ACACCGACCAAATCCACAACGACTATTGATTTCTCTCTACGATTGAGAATGAAAAGAGAG
 
. : . : . : . : . : . :
JMFS112C06+ ATTTTGAGGAAGTGAGGGTTTATTAATCTGCTATATACCTGAAATGAAACTTTTTTACTT
JMFF028M05+ ATTTTGAGGAAGTGAGGGTTTATTAATCTGCTATATACCTGAAATGAAACTTTTTTACTT
JMFF045E19+ ATTTTGAGGAAGTGAGGGTTTATTAATCTGCTATATACCTGAAATGAAACTTTTTTACTT
                      ____________________________________________________________
consensus ATTTTGAGGAAGTGAGGGTTTATTAATCTGCTATATACCTGAAATGAAACTTTTTTACTT
 
. : . : . : . : . : . :
JMFS112C06+ TTTCTTTTACGGAAGAAATTATTTGCACAAAAAAAAATTAAATTTAAAATTCTGGGAATT
JMFF028M05+ TTTCTTTTACGGAAGAAATTATTTGCAC-AAAAAAAATTAAATTTAAAATTCTGGGAATT
JMFF045E19+ TTTCTTTTACGGAAGAAATTATTTGCAC-AAAAAAAATTAAATTTAAAATTCTGGGAATT
                      ____________________________________________________________
consensus TTTCTTTTACGGAAGAAATTATTTGCAC-AAAAAAAATTAAATTTAAAATTCTGGGAATT
 
. : . : . : . : . : . :
JMFS112C06+ GACCTATAGTGTTGTGCCACGTTTAAGGGATGGCTTTATCAAGTCGGAGAGGGAAAGGGA
JMFF028M05+ GACCTATAGTGTTGTGCCACGTTTAAGGGATGGCTTTATCAAGTCGGAGAGGGAAAGGGA
JMFF045E19+ GACCTATAGTGTTGTGCCACGTTTAAGGGATGGCTTTATCAAGTCGGAGAGGGAAAGGGA
                      ____________________________________________________________
consensus GACCTATAGTGTTGTGCCACGTTTAAGGGATGGCTTTATCAAGTCGGAGAGGGAAAGGGA
 
. : . : . : . : . : . :
JMFS112C06+ TACGTGGCCGGAGAATCGGAGATTCCCGCCGCCTCTTTTTCTCAGTTTG
JMFF028M05+ TACGTGGCCGGAGAATCGGAGATTCCC
JMFF045E19+ TACGTGGCCGGAGAATCGGAGATTCCCGCCGCCTCTTTTTCTCAGTTTGTTTATCTTTTT
                      ____________________________________________________________
consensus TACGTGGCCGGAGAATCGGAGATTCCCGCCGCCTCTTTTTCTCAGTTTGTTTATCTTTTT