Previous Contig 001917:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025H01Sequence479001917 (11)pir|S65063|S650631e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16541008259 (9)
JMFF041D17Sequence662001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16
JMFF045B10Sequence619001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16284008259 (9)
JMFF049F20Sequence627001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16533008259 (9)gb:COTFIB_16483871e-05Gossypium hirsutum ORF with two tentative start codons, complete cds.
JMFN004H19Sequence616001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16
JMFN005A03Sequence619001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16
JMFN007D06Sequence621001917 (11)pir|S65063|S650635e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16
JMSF023A06Sequence486001917 (11)pir|S65063|S650632e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16669008259 (9)gb:AY389548_11781930.003Hyacinthus orientalis unknown mRNA.
JMSF046E16Sequence767001917 (11)pir|S65062|S650621e-06fiber protein E6 (clone CKE6-4A) - upland cotton>gb:GHU30506_1680151 Gossypium h543008259 (9)gb:HSU63332_20253713e-15Human super cysteine rich protein mRNA, partial cds.
JMSF046F10Sequence720001917 (11)pir|S65063|S650636e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16620008259 (9)gb:HSU63332_20253713e-26Human super cysteine rich protein mRNA, partial cds.
JMSF046M13Sequence727001917 (11)pir|S65063|S650636e-06fiber protein E6 (clones SIE6-2A and SIE6-3B) - sea-island cotton>gb:GBU30507_16157024226

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046M13+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMSF046M13+ CTCTGCGTGAATTTATCTTCGGGAAAGTTTGATTCTTGGTGGTTGTTGTTGTAGTAGTTG
                      ____________________________________________________________
consensus CTCTGCGTGAATTTATCTTCGGGAAAGTTTGATTCTTGGTGGTTGTTGTTGTAGTAGTTG
 
. : . : . : . : . : . :
JMFN007D06+ TCGGTGGTGAACTCGTTTTCCGTGAATCTT
JMSF046M13+ TTGCCGGCGCCGCCGTTGTAACGGCGGTTGTCGGTGGTGAACTCGTTTTCCGTGAATCTT
JMSF046F10+ TGAATCTT
JMSF046E16+ GGCGCCGCCGTTGTAACGGCGGTTGTCGGTGGTGAACTCGTTTTCCGTGAATCTT
                      ____________________________________________________________
consensus TTGCCGGCGCCGCCGTTGTAACGGCGGTTGTCGGTGGTGAACTCGTTTTCCGTGAATCTT
 
. : . : . : . : . : . :
JMFN007D06+ GTGTCGTCGGGGATGGTTGATTCTCTTGATCTGCCGCCGCCGTTGTGATAGTAGTACTGG
JMSF046M13+ GTGTCGTCGGGGATGGTTGATTCTCTTGATCTGCCGCCGCCGTTGTGATAGTAGTACTGG
JMSF046F10+ GTGTCGTCGGGGATGGTTGATTCTCTTGATCTGCCGCCGCCGTTGTGATAGTAGTACTGG
JMFN004H19+ TCTCTNGATCTGCCGCCGCCGTTGTGATAGTAGTACTGG
JMSF046E16+ GTGTCGTCGGGGATGGTTGATTCTCTTGATCTGCCGCCGCCGTTGTGATAGTAGTACTGG
JMFF041D17+ GG
                      ____________________________________________________________
consensus GTGTCGTCGGGGATGGTTGATTCTCTTGATCTGCCGCCGCCGTTGTGATAGTAGTACTGG
 
. : . : . : . : . : . :
JMFN007D06+ CGGGTATCGGCGGCCATGAATCTTGTGTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
JMSF046M13+ CGGGTATCGGCGGCCATGAATCTTGTGTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
JMSF046F10+ CGGGTATCGGCGGCCATGAATCTTGTGTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
JMFN004H19+ CGGGTATCGGCGGCCATGAATCTTGTGTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
JMSF046E16+ CGGGTATCGGCGGCCATGAATCTTGTGTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
JMFN005A03+ GTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
JMFF041D17+ CGGGTATCGGCGGCCATGAATCTTGTGTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
JMFF049F20+ GTCGGGCATTCTGATTTCTCCGGCGCCGTTG
JMFF045B10+ TTCTCCGGCGCCG-TG
                      ____________________________________________________________
consensus CGGGTATCGGCGGCCATGAATCTTGTGTCGTCGGGCATTCTTGATTCTCCGGCGCCGTTG
 
. : . : . : . : . : . :
JMFN007D06+ TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMSF046M13+ TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMSF046F10+ TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMFN004H19+ TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMSF046E16+ TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMFN005A03+ TAAAAACNCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMFF041D17+ TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMFF049F20+ TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
JMFF045B10+ TAAAAACCCCGGCGGTATTCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
                      ____________________________________________________________
consensus TAAAAACCCCGGCGGTTATCGGCGGCGGAGGTGGTGAACTCCTTGTCGTCCATGAACCTG
 
. : . : . : . : . : . :
JMFN007D06+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
JMSF046M13+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
JMSF046F10+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
JMFN004H19+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTTCGCCTCCGCCG
JMSF046E16+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
JMFN005A03+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
JMFF041D17+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
JMFF049F20+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
JMSF023A06+ CCTCCGCCG
JMFF025H01+ CCG
JMFF045B10+ GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
                      ____________________________________________________________
consensus GTGTCCTCGGGCATTCTCGATTCCCCGCCGCCGTTGTAGTACTCACCTCCGCCTCCGCCG
 
. : . : . : . : . : . :
JMFN007D06+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMSF046M13+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMSF046F10+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMFN004H19+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMSF046E16+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMFN005A03+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMFF041D17+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMFF049F20+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMSF023A06+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMFF025H01+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
JMFF045B10+ GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCCGCGGTTGTCGTTGTCGGCGGCGGCG
                      ____________________________________________________________
consensus GCGCCGGCGAACTCCTTGCCGCCGTTGTAGAACCGGCGGTTGTCGTTGTCGGCGGCGGCG
 
. : . : . : . : . : . :
JMFN007D06+ GCCATGAACCTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMSF046M13+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMSF046F10+ GCCATGAACTTAGCGTCATCATTATTGTTATCCTCCGGGACAGTTACATAGGCAACGGGG
JMFN004H19+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMSF046E16+ GCCATGAACTTAGCGTCATCATTATTGTTATCCTCCGGGACAGTTACATAGGCAACGGGG
JMFN005A03+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMFF041D17+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMFF049F20+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMSF023A06+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMFF025H01+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
JMFF045B10+ GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
                      ____________________________________________________________
consensus GCCATGAACTTAGCGTCATCATTATTGTTGTCCTCCGGGACAGTTACATAGGCAACGGGG
 
. : . : . : . : . : . :
JMFN007D06+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMSF046M13+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMSF046F10+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMFN004H19+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMSF046E16+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMFN005A03+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMFF041D17+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMFF049F20+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMSF023A06+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMFF025H01+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
JMFF045B10+ TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
                      ____________________________________________________________
consensus TTATAGTTCTTGGGAAGGTATTTCTTGTAAGGAACTTCCTCCGCCTCTGCATGGTTGTTG
 
. : . : . : . : . : . :
JMFN007D06+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMSF046M13+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMSF046F10+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMFN004H19+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMSF046E16+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMFN005A03+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMFF041D17+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMFF049F20+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMSF023A06+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMFF025H01+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
JMFF045B10+ ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
                      ____________________________________________________________
consensus ACGGCGGTGGCGGACGGAGGAAGCTGGCCGGATTCATGGCCGTAGAGGCCATAGCCGCTG
 
. : . : . : . : . : . :
JMFN007D06+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMSF046M13+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMSF046F10+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMFN004H19+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMSF046E16+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMFN005A03+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMFF041D17+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMFF049F20+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMSF023A06+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMFF025H01+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
JMFF045B10+ GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
                      ____________________________________________________________
consensus GTTTCATTCTCCGGGATGAAATTTGGTTCTTTCTGCAGAGGAACCACAGTTGCAGATTGC
 
. : . : . : . : . : . :
JMFN007D06+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAG
JMSF046M13+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMSF046F10+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMFN004H19+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMSF046E16+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMFN005A03+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMFF041D17+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMFF049F20+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMSF023A06+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMFF025H01+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
JMFF045B10+ TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
                      ____________________________________________________________
consensus TCTTTGCTGCTGCTATTGTTGTTGTTGTTGCTAGGGATTTTGTTGAAGAATTGGCTGTCT
 
. : . : . : . : . : . :
JMSF046M13+ CTTGC
JMSF046F10+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
JMFN004H19+ CTTGCTT-AAGAATTTGCAGG
JMSF046E16+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
JMFN005A03+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
JMFF041D17+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
JMFF049F20+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
JMSF023A06+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
JMFF025H01+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
JMFF045B10+ CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
                      ____________________________________________________________
consensus CTTGCTTGAAGAATTTGCAGGGAGGATAAGAGAGTGAGGAGGAAGAAGATGAAGATTTGG
 
. : . : . : . : . : . :
JMSF046F10+ TTGGGGGAAG-CCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGT
JMSF046E16+ TTGGGGGAAG-CCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGT
JMFN005A03+ TTGGGGGAAGCCCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTT
JMFF041D17+ TTGGGGGAAGCCCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGTGAA
JMFF049F20+ TTGGGGGAAG-CCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGTGAAGT
JMSF023A06+ TTGGGGGAAG-CCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGTGAAGT
JMFF025H01+ TTGGGGGAAG-CCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGTGAAGT
JMFF045B10+ TTGGGGGAAG-CCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGTGAAGTGTT
                      ____________________________________________________________
consensus TTGGGGGAAG-CCATGGAAGGAGGAGGAGAGAGAGAGAGGTTGTTGTATAGTGAAGTGTT