Previous Contig 001916:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045B05Sequence653001916 (3)gb:AK175936_18179242e-44Arabidopsis thaliana mRNA, partial cds, clone: RAFL22-61-H06.654001916 (3)gb:AK175936_18179241e-43Arabidopsis thaliana mRNA, partial cds, clone: RAFL22-61-H06.
JMFN013A24Sequence564001916 (3)gb:AK175164_18171521e-43Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-58-A11.>gb:AK175615_18176

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045B05- CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTGACATAAATAT
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTGACATAAATAT
 
. : . : . : . : . : . :
JMFN013A24+ AAATTAAATCCTTGTTTTGAAATTAACAATATAGTCCACACGA
rJMFF045B05- ATATATGTAATTGTAATAAATTAAATCCTTGTTTTGAAATTAACAATATAGTCCACACGA
                      ____________________________________________________________
consensus ATATATGTAATTGTAATAAATTAAATCCTTGTTTTGAAATTAACAATATAGTCCACACGA
 
. : . : . : . : . : . :
JMFN013A24+ AAACTTATTCCAAATTCATAAAAATGCACTCATTCGTGTACACATACATAATAAGCAATC
rJMFF045B05- AAACTTATTCCAAATTCATAAAAATGCACTCATTCGTGTACACATACATAATAAGCAATC
JMFF045B05+ TTCCAAATTCATAAAAATGCACTCATTCGTGTACACATACATAATAAGCAATC
                      ____________________________________________________________
consensus AAACTTATTCCAAATTCATAAAAATGCACTCATTCGTGTACACATACATAATAAGCAATC
 
. : . : . : . : . : . :
JMFN013A24+ AATCTCGTCTTGCTCCGATCCAACTCGGTTGTGTCTTCTCTACACAACAGTTGAGATGGA
rJMFF045B05- AATCTCGTCTTGCTCCGATCCAACTCGGTTGTGTCTTCTCTACACAACAGTTGAGATGGA
JMFF045B05+ AATCTCGTCTTGCTCCGATCCAACTCGGTTGTGTCTTCTCTACACAACAGTTGAGATGGA
                      ____________________________________________________________
consensus AATCTCGTCTTGCTCCGATCCAACTCGGTTGTGTCTTCTCTACACAACAGTTGAGATGGA
 
. : . : . : . : . : . :
JMFN013A24+ CGCAGCATTATTGCAGTGATTGAAGCCATACCACACTCCTCTGGGCACAAATCTGTTGTA
rJMFF045B05- CGCAGCATTATTGCAGTGATTGAAGCCATACCACACTCCTCTGGGCACAAATCTGTTGTA
JMFF045B05+ CGCAGCATTATTGCAGTGATTGAAGCCATACCACACTCCTCTGGGCACAAATCTGTTGTA
                      ____________________________________________________________
consensus CGCAGCATTATTGCAGTGATTGAAGCCATACCACACTCCTCTGGGCACAAATCTGTTGTA
 
. : . : . : . : . : . :
JMFN013A24+ TGTAAACGTAACATAATTGCGAGCAGAGATGTACACAGTCACCGTCTGCGGTTTCCAGCC
rJMFF045B05- TGTAAACGTAACATAATTGCGAGCAGAGATGTACACAGTCACCGTCTGCGGTTTCCAGCC
JMFF045B05+ TGTAAACGTAACATAATTGCGAGCAGAGATGTACACAGTCACCGTCTGCGGTTTCCAGCC
                      ____________________________________________________________
consensus TGTAAACGTAACATAATTGCGAGCAGAGATGTACACAGTCACCGTCTGCGGTTTCCAGCC
 
. : . : . : . : . : . :
JMFN013A24+ GTCCGATCCCACCCTGTATAGATACAGATAACACACCTGATCCATGCATGGCCCCCTAAT
rJMFF045B05- GTCCGATCCCACCCTGTATAGATACAGATAACACACCTGATCCATGCATGGCCCCCTAAT
JMFF045B05+ GTCCGATCCCACCCTGTATAGATACAGATAACACACCTGATCCATGCATGGCCCCCTAAT
                      ____________________________________________________________
consensus GTCCGATCCCACCCTGTATAGATACAGATAACACACCTGATCCATGCATGGCCCCCTAAT
 
. : . : . : . : . : . :
JMFN013A24+ CTTGAATGTATCCTTGGAGCATCTCTCGAATGTGTCCGAATCTGGGTCGTCAATTCTTGC
rJMFF045B05- CTTGAATGTATCCTTGGAGCATCTCTCGAATGTGTCCGAATCTGGGTCGTCAATTCTTGC
JMFF045B05+ CTTGAATGTATCCTTGGAGCATCTCTCGAATGTGTCCGAATCTGGGTCGTCAATTCTTGC
                      ____________________________________________________________
consensus CTTGAATGTATCCTTGGAGCATCTCTCGAATGTGTCCGAATCTGGGTCGTCAATTCTTGC
 
. : . : . : . : . : . :
JMFN013A24+ TGCATATACCTCATTGCCATAAGCATCACCAAATGAAAGGCTGATTTGATCTCTAGTGTA
rJMFF045B05- TGCATATACCTCATTGCCATAAGCATCACCAAATGAAAGGCTGATTTGATCTCTAGTGTA
JMFF045B05+ TGCATATACCTCATTGCCATAAGCATCACCAAATGAAAGGCTGATTTGATCTCTAGTGTA
                      ____________________________________________________________
consensus TGCATATACCTCATTGCCATAAGCATCACCAAATGAAAGGCTGATTTGATCTCTAGTGTA
 
. : . : . : . : . : . :
JMFN013A24+ TTTTACTGAGGAACAGCTTGTTCTGATGTCCACTGTGTATGAACACTGGGCTGCACCAAT
rJMFF045B05- TTTTACTGAGGAACAGCTTGTTCTGATGTCCACTGTGTATGAACACTGGGCTGCACCAAT
JMFF045B05+ TTTTACTGAGGAACAGCTTGTTCTGATGTCCACTGTGTATGAACACTGGGCTGCACCAAT
                      ____________________________________________________________
consensus TTTTACTGAGGAACAGCTTGTTCTGATGTCCACTGTGTATGAACACTGGGCTGCACCAAT
 
. : . : . : . : . : . :
JMFN013A24+ CTGTGGGTTGGCTTTGACAGTGAAAGACCTGTTAAAGTGGG
rJMFF045B05- CTGTGGGTTGGCTTTGACAGTGAAAGACCTGTTAAAGTGGGGCAGTTCTGAAACATCTCT
JMFF045B05+ CTGTGGGTTGGCTTTGACAGTGAAAGACCTGTTAAAGTGGGGCAGTTCTGAAACATCTCT
                      ____________________________________________________________
consensus CTGTGGGTTGGCTTTGACAGTGAAAGACCTGTTAAAGTGGGGCAGTTCTGAAACATCTCT
 
. : . : . : . : . : . :
rJMFF045B05- TGA
JMFF045B05+ TGAAGCTGTAGATGTGGTGAAGAAGAAGAAGAAGAAGAAGAAGGCAAGAAGGAGAAGTAT
                      ____________________________________________________________
consensus TGAAGCTGTAGATGTGGTGAAGAAGAAGAAGAAGAAGAAGAAGGCAAGAAGGAGAAGTAT
 
. : . : . : . : . : . :
JMFF045B05+ TGAGAGCTTTCCACCCATTTTCATGGCTGCTTCAAATCCACCTATTAGACGATGACTGAT
                      ____________________________________________________________
consensus TGAGAGCTTTCCACCCATTTTCATGGCTGCTTCAAATCCACCTATTAGACGATGACTGAT