Previous Contig 001915:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045A05Sequence635001915 (2)gb:AC008262_15366092e-13Genomic sequence for Arabidopsis thaliana BAC F4N2 from chromosome I, complete s620010489 (2)gb:AY072199_15670871e-41Arabidopsis thaliana putative serine threonine kinase (At1g69220) mRNA, complete
JMFF045O02Sequence634001915 (2)gb:AC008262_15366092e-13Genomic sequence for Arabidopsis thaliana BAC F4N2 from chromosome I, complete s608010489 (2)gb:AY072199_15670871e-41Arabidopsis thaliana putative serine threonine kinase (At1g69220) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045O02+ CTATATCGGCAACT-TAAGACCAGCAGGAACTGTA
JMFF045A05+ CTATATCGGCAACTNTAAGACCAGCAGGAACTGTA
                      ____________________________________________________________
consensus CTATATCGGCAACTNTAAGACCAGCAGGAACTGTA
 
. : . : . : . : . : . :
JMFF045O02+ TCTCCAAATGTCTCATTTACTTTGGGACCGCCTCCTAAATCTTGTTGAGTGGTCACTGAA
JMFF045A05+ TCTCCAAATGTCTCATTTACTTTGGGACCGCCTCCTAAATCTTGTTGAGTGGTCACTGAA
                      ____________________________________________________________
consensus TCTCCAAATGTCTCATTTACTTTGGGACCGCCTCCTAAATCTTGTTGAGTGGTCACTGAA
 
. : . : . : . : . : . :
JMFF045O02+ GCAATTTTCTGTGCTTCCGCCATTGATGACCTAATTTGTTTTGCCTTCTGAATCCTGGGT
JMFF045A05+ GCAATTTTCTGTGCTTCCGCCATTGATGACCTAATTTGTTTTGCCTTCTGAATCCTGGGT
                      ____________________________________________________________
consensus GCAATTTTCTGTGCTTCCGCCATTGATGACCTAATTTGTTTTGCCTTCTGAATCCTGGGT
 
. : . : . : . : . : . :
JMFF045O02+ AGCATCGCACAAGCTCCACCTTTACACTTCTCAATGAATTTGTGCATTTCTCTTTGTCCT
JMFF045A05+ AGCATCGCACAAGCTCCACCTTTACACTTCTCAATGAATTTGTGCATTTCTCTTTGTCCT
                      ____________________________________________________________
consensus AGCATCGCACAAGCTCCACCTTTACACTTCTCAATGAATTTGTGCATTTCTCTTTGTCCT
 
. : . : . : . : . : . :
JMFF045O02+ CAAGCATTGGAGCTGGTTCTATTGATATCATAAAGAGTACCTATCCAAAATTACAAACAT
JMFF045A05+ CAAGCATTGGAGCTGGTTCTATTGATATCATAAAGAGTACCTATCCAAAATTACAAACAT
                      ____________________________________________________________
consensus CAAGCATTGGAGCTGGTTCTATTGATATCATAAAGAGTACCTATCCAAAATTACAAACAT
 
. : . : . : . : . : . :
JMFF045O02+ ATTAAGTCTCTGAAAGGAGTGAAAGGTATATTTAGAAAGAGATTATACTGAAATGTCATT
JMFF045A05+ ATTAAGTCTCTGAAAGGAGTGAAAGGTATATTTAGAAAGAGATTATACTGAAATGTCATT
                      ____________________________________________________________
consensus ATTAAGTCTCTGAAAGGAGTGAAAGGTATATTTAGAAAGAGATTATACTGAAATGTCATT
 
. : . : . : . : . : . :
JMFF045O02+ AAGAAACCCTGAAGTGCAAAATCATGCTTCAATACAGGATGGAGTAATTGATTAGTCCTA
JMFF045A05+ AAGAAACCCTGAAGTGCAAAATCATGCTTCAATACAGGATGGAGTAATTGATTAGTCCTA
                      ____________________________________________________________
consensus AAGAAACCCTGAAGTGCAAAATCATGCTTCAATACAGGATGGAGTAATTGATTAGTCCTA
 
. : . : . : . : . : . :
JMFF045O02+ TGAACTGGAAACTCAGTATTTGACCATCCATCAGCTTTTAAGCATTGTAGAAAACTTTGA
JMFF045A05+ TGAACTGGAAACTCAGTATTTGACCATCCATCAGCTTTTAAGCATTGTAGAAAACTTTGA
                      ____________________________________________________________
consensus TGAACTGGAAACTCAGTATTTGACCATCCATCAGCTTTTAAGCATTGTAGAAAACTTTGA
 
. : . : . : . : . : . :
JMFF045O02+ ATTACATAGAAATGTGTAAGCATACAATAATAACAATAGACACTTCCCTATTTTGTACTT
JMFF045A05+ ATTACATAGAAATGTGTAAGCATACAATAATAACAATAGACACTTCCCTATTTTGTACTT
                      ____________________________________________________________
consensus ATTACATAGAAATGTGTAAGCATACAATAATAACAATAGACACTTCCCTATTTTGTACTT
 
. : . : . : . : . : . :
JMFF045O02+ CAATCTCCATCTTTATTGTCCTCTTCTCCACTCTTCTTTCCCAGTCCTCTGAGTCCAAAT
JMFF045A05+ CAATCTCCATCTTTATTGTCCTCTTCTCCACTCTTCTTTCCCAGTCCTCTGAGTCCAAAT
                      ____________________________________________________________
consensus CAATCTCCATCTTTATTGTCCTCTTCTCCACTCTTCTTTCCCAGTCCTCTGAGTCCAAAT
 
. : . : . : . : . : . :
JMFF045O02+ TGCTCGACACATTGAGGGAATCATAAAATGAAACTAAAGGGAGGTGAAGTGTGCTGACAT
JMFF045A05+ TGCTCGACACATTGAGGGAATCATAAAATGAAACTAAAGGGAGGTGAAGTGTGCTGACAT
                      ____________________________________________________________
consensus TGCTCGACACATTGAGGGAATCATAAAATGAAACTAAAGGGAGGTGAAGTGTGCTGACAT