Previous Contig 001901:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044J03Sequence644001901 (2)gb:AX025516_14569699e-56Sequence 42 from Patent WO0032789.602021708gb:AX025516_14569693e-63Sequence 42 from Patent WO0032789.
JMFS019C12Sequence587001901 (2)gb:AX025516_14569695e-53Sequence 42 from Patent WO0032789.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044J03+ CGCTGAGTTAGTGCGGCGCGGCCGGAAATTCGCCGGGTTAAAAA
                      ____________________________________________________________
consensus CGCTGAGTTAGTGCGGCGCGGCCGGAAATTCGCCGGGTTAAAAA
 
. : . : . : . : . : . :
JMFS019C12+ GTCCCAGACCGGTTTCTGTTTGAGCTCGGTGGCGGGTCGCCGCTTCCCGGCCG
JMFF044J03+ TATGGCGGTCCCAGACCGGTTTCTGTTTGAGCTCGGTGGCGGGTCGCCGCTTCCCGGCCG
                      ____________________________________________________________
consensus TATGGCGGTCCCAGACCGGTTTCTGTTTGAGCTCGGTGGCGGGTCGCCGCTTCCCGGCCG
 
. : . : . : . : . : . :
JMFS019C12+ CTAACTCGGCGAAGAAGTTGAGAAACTCGGCGCTGCCGATTCCGTCGCAGAGACAATGGT
JMFF044J03+ CTAACTCGGCGAAGAAGTTGAGAAACTCGGCGCTGCCGATTCCGTCGCAGAGACAATGGT
                      ____________________________________________________________
consensus CTAACTCGGCGAAGAAGTTGAGAAACTCGGCGCTGCCGATTCCGTCGCAGAGACAATGGT
 
. : . : . : . : . : . :
JMFS019C12+ TGAACCCGACGGCCAACGTGGCAGCATTACCCGACAGCCACGTCAGCTGGACGACCAACG
JMFF044J03+ TGAACCCGACGGCCAACGTGGCAGCATTACCCGACAGCCACGTCAGCTGGACGACCAACG
                      ____________________________________________________________
consensus TGAACCCGACGGCCAACGTGGCAGCATTACCCGACAGCCACGTCAGCTGGACGACCAACG
 
. : . : . : . : . : . :
JMFS019C12+ GTGGGGCCCCTTTGAGCACATCCACCACGTACAACGACAGCAGCATCCGCCACTGCGCGC
JMFF044J03+ GTGGGGCCCCTTTGAGCACATCCACCACGTACAACGACAGCAGCATCCGCCACTGCGCGC
                      ____________________________________________________________
consensus GTGGGGCCCCTTTGAGCACATCCACCACGTACAACGACAGCAGCATCCGCCACTGCGCGC
 
. : . : . : . : . : . :
JMFS019C12+ CGCACCGCGGCGCCCGTTCAAACTCCGCCGCCGTGAGCTCCGACACCGCCTCAATAAAAA
JMFF044J03+ CGCACCGCGGCGCCCGTTCAAACTCCGCCGCCGTGAGCTCCGACACCGCCTCAATAAAAA
                      ____________________________________________________________
consensus CGCACCGCGGCGCCCGTTCAAACTCCGCCGCCGTGAGCTCCGACACCGCCTCAATAAAAA
 
. : . : . : . : . : . :
JMFS019C12+ CCGCCCCCTGGCCGCGGCACACCACCTCCAGACCGGACCCGTCCGGCCGCGCCCTGACTC
JMFF044J03+ CCGCCCCCTGGCCGCGGCACACCACCTCCAGACCGGACCCGTCCGGCCGCGCCCTGACTC
                      ____________________________________________________________
consensus CCGCCCCCTGGCCGCGGCACACCACCTCCAGACCGGACCCGTCCGGCCGCGCCCTGACTC
 
. : . : . : . : . : . :
JMFS019C12+ TTCCGGCGAGCGGATAGTACGGAACCAAGGCACGCCCCAGCGCGTCCTTCACTCTGGCCG
JMFF044J03+ TTCCGGCGAGCGGATAGTACGGAACCAAGGCACGCCCCAGCGCGTCCTTCACTCTGGCCG
                      ____________________________________________________________
consensus TTCCGGCGAGCGGATAGTACGGAACCAAGGCACGCCCCAGCGCGTCCTTCACTCTGGCCG
 
. : . : . : . : . : . :
JMFS019C12+ CCGTCGCCGCCCTATCCACGGCGGCGCTGGCCGTCTTGTACACCAACAAGTACTCTATAG
JMFF044J03+ CCGTCGCCGCCCTATCCACGGCGGCGCTGGCCGTCTTGTACACCAACAAGTACTCTATAG
                      ____________________________________________________________
consensus CCGTCGCCGCCCTATCCACGGCGGCGCTGGCCGTCTTGTACACCAACAAGTACTCTATAG
 
. : . : . : . : . : . :
JMFS019C12+ TAAACCGCAGAAAAGGCTGAGAATCCAAGGCAGTGAGGGGAAGAACCTGAACCGGCGTCG
JMFF044J03+ TAAACCGCAGAAAAGGCTGAGAATCCAAGGCAGTGAGGGGAAGAACCTGAACCGGCGTCG
                      ____________________________________________________________
consensus TAAACCGCAGAAAAGGCTGAGAATCCAAGGCAGTGAGGGGAAGAACCTGAACCGGCGTCG
 
. : . : . : . : . : . :
JMFS019C12+ GCTCCGACGGGCTCACCAAAACAGCTTCTTTTACATGTATGGAG
JMFF044J03+ GCTCCGACGGGCTCACCAAAACAGCTTCTTTTACATGTATGGAGGTCGCCATTTTTGCAT
                      ____________________________________________________________
consensus GCTCCGACGGGCTCACCAAAACAGCTTCTTTTACATGTATGGAGGTCGCCATTTTTGCAT