Previous Contig 001899:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042B20Sequence537001899 (36)gb:AE016757_3247243e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553502010177 (30)gb:ECU82598_1346884e-53Escherichia coli genomic sequence of minutes 9 to 12.
JMFF042L24Sequence622001899 (36)gb:AE016757_3247246e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553525010177 (30)gb:ECU82598_1346883e-89Escherichia coli genomic sequence of minutes 9 to 12.
JMFF043K06Sequence181001899 (36)gb:AE016757_3247242e-26Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553
JMFF044E15Sequence641001899 (36)gb:AE016757_3247244e-72Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553521010177 (30)gb:ECU82598_1346882e-92Escherichia coli genomic sequence of minutes 9 to 12.
JMFF044I08Sequence676001899 (36)gb:AE016757_3247247e-74Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553633010177 (30)gb:ECU82598_134688e-107Escherichia coli genomic sequence of minutes 9 to 12.
JMFF044J01Sequence617001899 (36)gb:AE016757_3247244e-58Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553322010177 (30)gb:ECU82598_1346882e-53Escherichia coli genomic sequence of minutes 9 to 12.
JMFF044M21Sequence513001899 (36)gb:AE016757_3247244e-62Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553646010177 (30)gb:ECU82598_134688e-112Escherichia coli genomic sequence of minutes 9 to 12.
JMFF044N14Sequence633001899 (36)gb:AE016757_3247243e-72Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553578010177 (30)gb:ECU82598_134688e-104Escherichia coli genomic sequence of minutes 9 to 12.
JMFF044P12Sequence651001899 (36)gb:AE016757_3247244e-72Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553624010177 (30)gb:ECU82598_134688e-114Escherichia coli genomic sequence of minutes 9 to 12.
JMFF045E10Sequence647001899 (36)gb:AE016757_3247243e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553636010177 (30)gb:ECU82598_134688e-117Escherichia coli genomic sequence of minutes 9 to 12.
JMFF045K14Sequence620001899 (36)gb:AE016757_3247243e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553618010177 (30)gb:ECU82598_134688e-107Escherichia coli genomic sequence of minutes 9 to 12.
JMFF045N20Sequence597001899 (36)gb:AE016757_3247243e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553609010177 (30)gb:ECU82598_134688e-107Escherichia coli genomic sequence of minutes 9 to 12.
JMFF046B09Sequence499001899 (36)gb:AE016757_3247241e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553408010177 (30)gb:ECU82598_1346888e-70Escherichia coli genomic sequence of minutes 9 to 12.
JMFF046E22Sequence537001899 (36)gb:AE016757_3247242e-71Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553517010177 (30)gb:ECU82598_1346881e-91Escherichia coli genomic sequence of minutes 9 to 12.
JMFF046J20Sequence437001899 (36)gb:AE016757_3247241e-71Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553460010177 (30)gb:ECU82598_1346885e-81Escherichia coli genomic sequence of minutes 9 to 12.
JMFF046M14Sequence562001899 (36)gb:AE016757_3247246e-74Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553520010177 (30)gb:ECU82598_1346883e-84Escherichia coli genomic sequence of minutes 9 to 12.
JMFF047B01Sequence645001899 (36)gb:AE016757_3247241e-72Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553341010177 (30)gb:ECU82598_1346882e-56Escherichia coli genomic sequence of minutes 9 to 12.
JMFF047D10Sequence588001899 (36)gb:AE016757_3247244e-57Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553199021783
JMFF047F14Sequence603001899 (36)gb:AE016757_3247248e-71Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553536010177 (30)gb:ECU82598_1346882e-96Escherichia coli genomic sequence of minutes 9 to 12.
JMFF047K19Sequence353001899 (36)gb:AE016757_3247247e-52Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553250010177 (30)gb:ECU82598_1346882e-36Escherichia coli genomic sequence of minutes 9 to 12.
JMFF048A07Sequence603001899 (36)gb:AE016757_3247242e-73Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553403013227 (2)
JMFF048D20Sequence429001899 (36)gb:AE016757_3247242e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553420010177 (30)gb:ECU82598_1346885e-72Escherichia coli genomic sequence of minutes 9 to 12.
JMFF048J06Sequence487001899 (36)gb:AE016757_3247246e-73Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553448010177 (30)gb:ECU82598_1346889e-77Escherichia coli genomic sequence of minutes 9 to 12.
JMFF049D15Sequence615001899 (36)gb:AE016757_3247242e-25Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553
JMFF049E17Sequence403001899 (36)gb:AE016757_3247241e-55Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553271010177 (30)gb:ECU82598_1346882e-06Escherichia coli genomic sequence of minutes 9 to 12.
JMFF049H08Sequence432001899 (36)gb:AE016757_3247248e-30Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553211010177 (30)gb:ECU82598_1346884e-29Escherichia coli genomic sequence of minutes 9 to 12.
JMFF049J11Sequence554001899 (36)gb:AE016757_3247249e-73Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553556010177 (30)gb:ECU82598_1346883e-88Escherichia coli genomic sequence of minutes 9 to 12.
JMFF050M13Sequence552001899 (36)gb:AE016757_3247249e-79Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553313010177 (30)gb:ECU82598_1346884e-51Escherichia coli genomic sequence of minutes 9 to 12.
JMFF050O02Sequence445001899 (36)gb:AE016757_3247244e-64Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553411010177 (30)gb:ECOENTF_1285443e-60Escherichia coli enterobactin (entF) gene, complete cds.
JMFF051B19Sequence481001899 (36)gb:AE016757_3247244e-71Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553452010177 (30)gb:ECU82598_1346882e-73Escherichia coli genomic sequence of minutes 9 to 12.
JMFF051F04Sequence605001899 (36)gb:AE016757_3247241e-60Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553416010177 (30)gb:ECU82598_1346884e-71Escherichia coli genomic sequence of minutes 9 to 12.
JMFF051G04Sequence149001899 (36)gb:AE016757_3247244e-21Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553
JMFF051H23Sequence515001899 (36)gb:AE016757_3247244e-70Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553467010177 (30)gb:ECU82598_1346887e-70Escherichia coli genomic sequence of minutes 9 to 12.
JMFF051I01Sequence397001899 (36)gb:AE016757_3247243e-51Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553
JMFF051J01Sequence165001899 (36)
JMFF051M14Sequence573001899 (36)gb:AE016757_3247247e-71Escherichia coli CFT073 section 3 of 18 of the complete genome.>gb:AE014075_9553560010177 (30)gb:ECU82598_1346882e-95Escherichia coli genomic sequence of minutes 9 to 12.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047B01+ GGGGCAGAACGGCGCAG
JMFF044J01+ GGGGCAGAACGGGGCA-
JMFF044E15+ GGGGGCAGAACGGCGCAG
JMFF045K14+ CAGAACGGCGCAG
JMFF045E10+ GGGGGCAGAACGGCGCAG
JMFF042L24+ GGGGCAGANCGGCGCAG
JMFF044N14+ CGGCGCAG
JMFF044I08+ CCCAGCCCTCACCCTGGAAGGGAGAGGGGGCAGAACGGCGCAG
                      ____________________________________________________________
consensus CCCAGCCCTCACCCTGGAAGGGAGAGGGGGCAGAACGGCGCAG
 
. : . : . : . : . : . :
JMFF047B01+ GACATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF044J01+ GACATCGCATTGCGGTTATGGGAATCCATCAATAA-GCGTCTCATTTCGATTGTAACCAC
JMFF047D10+ AATAATGCTTCTCATTTTCATGGTACCCCC
JMFF044E15+ GACATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF045K14+ GACATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATGGTAACCAC
JMFF045N20+ AATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF045E10+ GACATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF042L24+ GACATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF044N14+ GTCATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF047F14+ GAATCCATCAATAATGCTTCTCATTTTCATGGTAACCAC
JMFF048A07+ AATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF051M14+ TGTACCCAC
JMFF044M21+ AATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
JMFF051F04+ AATCCATCAATAATGCTTCTCATGTTCATGTAANCCAC
JMFF044I08+ GACATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
                      ____________________________________________________________
consensus GACATCACATTGCGCTTATGCGAATCCATCAATAATGCTTCTCATTTTCATTGTAACCAC
 
. : . : . : . : . : . :
JMFF047B01+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF046E22+ CAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF044J01+ AACCAGATTCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGGCA-TAGTGCGCGT
JMFF044P12+ GCGT
JMFF051H23+ GAGTTGACA-TAGTGCGCGT
JMFF047D10+ AACCAGATGCAAGCCCGGGTTGCAGAGTGCGGTACCTCAAGAGTGGACA-TAGTNCG-GT
JMFF044E15+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF045K14+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF045N20+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAG-TGACATTAGTGCGCGT
JMFF042B20+ AACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF045E10+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF042L24+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF044N14+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF047F14+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF049D15+ GCGT
JMFF048A07+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF051M14+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF049J11+ ACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF046M14+ CCCCGAGTTGCAGATTGCGTTACGTCAAGAGTTGACA-TAGTGCGCGT
JMFF050M13+ CCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF044M21+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF051F04+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
JMFF044I08+ AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
                      ____________________________________________________________
consensus AACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACA-TAGTGCGCGT
 
. : . : . : . : . : . :
JMFF047B01+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF046E22+ T-GCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCAGTAT-TAA-AGCCTTTATC
JMFF044J01+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF044P12+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF051H23+ TTGC-TTTAGGTTAGCGGACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF046B09+ TGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF047D10+ TGGC-TTTAGGGTAGC-GACCGAAAATTGAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF044E15+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF045K14+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF045N20+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF042B20+ TTGC-TTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTATGTAAGAGCCTTTATC
JMFF045E10+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF042L24+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATGATTAT-TAA-AGCCTTTATC
JMFF044N14+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF051B19+ ATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF047F14+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF049D15+ TTGCTTTTAGGTTACC-GTCCGAAAATAT-AATGATAATCATGAT-TAA-AGCCTTATTC
JMFF048A07+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF051M14+ TTGCTTTTAGGTTAGC-GCCCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF049J11+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF046M14+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF050O02+ GCCTTTATC
JMFF050M13+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF044M21+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF048J06+ CGAAAATATAAATGATAATCATTAT-TAA-AGCGTTTATC
JMFF051F04+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
JMFF044I08+ TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
                      ____________________________________________________________
consensus TTGCTTTTAGGTTAGC-GACCGAAAATATAAATGATAATCATTAT-TAA-AGCCTTTATC
 
. : . : . : . : . : . :
JMFF047B01+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF046E22+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF044J01+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF044P12+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF051H23+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF046B09+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF047D10+ ATTTGGTGGAGGATGATATGGATACGTGCACT-GGGTGAGGGAAGTACAGCAGA-CCAT-
JMFF044E15+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF045K14+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF045N20+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF051I01+ TTTTGTGGAGGATGATAGGGATGCGT-CGCT-GGCTGA-GGAAGTACAGCAGG-CCAT-
JMFF042B20+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF045E10+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF042L24+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF044N14+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF051B19+ TTTGTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF047F14+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF049E17+ GGAAGTACAGCAGA-CCAT-
JMFF049D15+ ATTTTGGGGAGGAGAATAGTGATGCGT-CGCTGGGCGGG-GGAAGTGCAGCAGAGCCAG-
JMFF048A07+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF051M14+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF049J11+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF046M14+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF050O02+ ATTTTGTGGAGGATGATAGGGATACGT-CACT-GTCTGA-GGAAGTACAGCAGA-CCATG
JMFF049H08+ CTGA-GGAAGTACAGCAGA-CCAT-
JMFF050M13+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF044M21+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF048J06+ ATTTGGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF046J20+ GATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF048D20+ GATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
JMFF051F04+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGNNCANCNNN-CCNN-
JMFF044I08+ ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
                      ____________________________________________________________
consensus ATTTTGTGGAGGATGATATGGATACGT-CACT-GGCTGA-GGAAGTACAGCAGA-CCAT-
 
. : . : . : . : . : . :
JMFF047B01+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF046E22+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF044J01+ GGCAACGCTGG-CGCCCAATC-GTTGTTTCTTTAGGTCGCCGTGCCGCAGTTTGTACGAC
JMFF044P12+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF051H23+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF046B09+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF047D10+ GGCAACACTTG-GGCCCAATC-GCTTTTTCTTTATGTCGCCGTGCCGCAGTTT-TAGGAC
JMFF044E15+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF045K14+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF045N20+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF051I01+ GGCAACACTGG-CGCCCAATCGGGTTTTTCTTTATGTCGCCGTACCGCAGTTT-TGCGAC
JMFF042B20+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF045E10+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF047K19+ CTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF042L24+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF044N14+ GGCAACACTTG-CGGTCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF051B19+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF047F14+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF049E17+ GGCAACACTTG-GGCCCAGTG-GTTTTTTGTGTAGGTGGCCGTACGGCAGTTG-TGCGAG
JMFF049D15+ GGCATCAGTGG-CGCGCAATG-GGTTGTTGTGTAGGTCGCCGTGCCGCGGTTT-TACGAC
JMFF048A07+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF051M14+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF049J11+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF046M14+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF050O02+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTGTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF049H08+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTATATGTCGCCGTACCGCAGTTT-TACGAC
JMFF050M13+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF044M21+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF048J06+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF046J20+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF048D20+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
JMFF051F04+ NNNAACAGGGGCCTGTCCCTC-CXXXXXXXXXXXXXXXXXXXXXCCGCAGTTT-TACGAC
JMFF044I08+ GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
                      ____________________________________________________________
consensus GGCAACACTTG-CGCCCAATC-GCTTTTTCTTTATGTCGCCGTACCGCAGTTT-TACGAC
 
. : . : . : . : . : . :
JMFF047B01+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF046E22+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF044J01+ GTCAGGATGTTTCGCCCGCT-TGGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF044P12+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF051H23+ GTCAGGATGTTTCGCCCGCT-TCGATGAAGCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF046B09+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGTACGGGGATTCGCCCGACAGTC
JMFF047D10+ GTCAGGATGTTTCGCCCGCT-TGGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF044E15+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF045K14+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF045N20+ GTCAGGATGTTTCGCCCGTT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF051I01+ GTCAGGATGTTTCGCCGGCT-TCGATGTACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF042B20+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF045E10+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF047K19+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF042L24+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF044N14+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF051B19+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF047F14+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF049E17+ GTCAGGATGTGTCGCCCGCT-TTGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF049D15+ GTCA-GATGTTTCGGCCGCTGTCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF048A07+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF051M14+ GTCAGGATGTTTCGCCCGTT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF049J11+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF046M14+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF050O02+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF049H08+ GTCAGGATTTGTCGCCCGCT-TCGATGATCCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF050M13+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF044M21+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF048J06+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF046J20+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF048D20+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF051F04+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
JMFF044I08+ GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
                      ____________________________________________________________
consensus GTCAGGATGTTTCGCCCGCT-TCGATGAACCGGCTGTGAACGGGGATTCGCCCGACAGTC
 
. : . : . : . : . : . :
JMFF047B01+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF046E22+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF044J01+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-TCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF044P12+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF051H23+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF046B09+ CCTTCCAGCAGAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF047D10+ CCTTCCAGCAAAGACTCGCC-GCGCTGTTT-GCGGATGCCAAAGCGCAGGGCATCAAAAA
JMFF044E15+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF045K14+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF045N20+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF051I01+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCGGATGCCAAAGCGCAGGGCATCAAAAA
JMFF043K06+ TTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF051G04+ AGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF042B20+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF045E10+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF047K19+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF042L24+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF044N14+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF051B19+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF047F14+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF049E17+ CCTTCCAGCAAGAACTGGCC-GCGCGGTTG-GGCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF049D15+ CCTTCCAGCAAAAACTCGCCGGCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF048A07+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF051M14+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF049J11+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF046M14+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF050O02+ CCTTCCAGCAAAAGCTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF049H08+ CCTTCCAGCAAAAGCTCACC-GCGCTGTTTGGCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF050M13+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF044M21+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF048J06+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF046J20+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF048D20+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF051F04+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
JMFF044I08+ CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
                      ____________________________________________________________
consensus CCTTCCAGCAAAAACTCGCC-GCGCTGTTT-GCCGATGCCAAAGCGCAGGGCATCAAAAA
 
. : . : . : . : . : . :
JMFF047B01+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF046E22+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF044J01+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTGGTCGC-GGTATA
JMFF044P12+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF051H23+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF046B09+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF047D10+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGTGCAGCCTTCGTCGC-TGTATA
JMFF044E15+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF045K14+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF045N20+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF051I01+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF043K06+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF051G04+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF042B20+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF045E10+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF047K19+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF042L24+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF044N14+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF051B19+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF047F14+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF049E17+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF049D15+ TTCGCGTGGATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCGTTCGTCGC-TGTATA
JMFF048A07+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF051M14+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF049J11+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF046M14+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF050O02+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF049H08+ TCCG-GT-GATGGTCGGTGCGATTCCCTTCGATCCACGT-CAGCAGTCGTCGC-TGTATA
JMFF050M13+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF044M21+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF048J06+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF046J20+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF048D20+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF051F04+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
JMFF051J01+ GGGCGATTCCCTTGGATCCACGT-CAGCCTTCGTCGCGTGTATA
JMFF044I08+ TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
                      ____________________________________________________________
consensus TCCG-GT-GATGGTCGGGGCGATTCCCTTCGATCCACGT-CAGCCTTCGTCGC-TGTATA
 
. : . : . : . : . : . :
JMFF047B01+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF046E22+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF044J01+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCGCGCCGT-TT
JMFF044P12+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF051H23+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF046B09+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF047D10+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF044E15+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF045K14+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF045N20+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF051I01+ TTCGTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAGCAAGCTTCCGCACGCCGT-TT
JMFF043K06+ TTCCTGAATCCTGGCAGTCGTTC-TCCGGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF051G04+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAA
JMFF042B20+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF045E10+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF047K19+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF042L24+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF044N14+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF051B19+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF047F14+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF049E17+ TTCCGGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGGTTCCGCACGCCGT-TT
JMFF049D15+ TTCGTGAATCATGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGTGGT
JMFF048A07+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF051M14+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF049J11+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF046M14+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF050O02+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-GT
JMFF049H08+ TTCCTGAATGCTGGCAGTCGTTC-TCCCGTCAGGAAAAGCAAGCTTCCGCACGCCGT-TT
JMFF050M13+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF044M21+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF048J06+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF046J20+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF048D20+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF051F04+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
JMFF051J01+ TTCGTGAATCGTGGCAATCGTTCTTCCCGTCAGGAAAANCAANCTTCCGCACGCCGT-TT
JMFF044I08+ TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
                      ____________________________________________________________
consensus TTCCTGAATCCTGGCAGTCGTTC-TCCCGTCAGGAAAAACAAGCTTCCGCACGCCGT-TT
 
. : . : . : . : . : . :
JMFF047B01+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF046E22+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF044J01+ CACCCGCAGC-CAGTCGCGGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF044P12+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF051H23+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF046B09+ CACCCGCAGT-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF047D10+ CGCCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACGCCCAGGCAATTCC-GGAGCAAAC-C
JMFF044E15+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF045K14+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF045N20+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF051I01+ GACCCGCAGC-CAGTCGCTGAAG-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAA
JMFF043K06+ CACCCGCAGC-C
JMFF042B20+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF045E10+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF047K19+ GTCCCGCAGC-CAGTCGCTGAAT-GTGTTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF042L24+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF044N14+ CACCCGCAGC-CAGTCGCTGGAT-GTGGTGGAACG-CCAGGCAATTCGTGGAGCAAAC-C
JMFF051B19+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF047F14+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF049E17+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF049D15+ CACCCGCAGC-CAGTCGGTGAAT-GTGGTGGAACG-GCAGGCAATTCC-GGAGCAAAC-C
JMFF048A07+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF051M14+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF049J11+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF046M14+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF050O02+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACT-CCAGGCAATTCC-GGAGCAAAC-C
JMFF049H08+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACTGCCAGGCAATTGCGTGAGCAAACGC
JMFF050M13+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF044M21+ CACCCGCAGC-CAGTCG
JMFF048J06+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF046J20+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF048D20+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF051F04+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
JMFF051J01+ CACCCGCAGCTCAGTGGCGGAATAGTGGTGGAACGTGCAGGCAATTCCTGGAGCAAAC-C
JMFF044I08+ CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
                      ____________________________________________________________
consensus CACCCGCAGC-CAGTCGCTGAAT-GTGGTGGAACG-CCAGGCAATTCC-GGAGCAAAC-C
 
. : . : . : . : . : . :
JMFF047B01+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF046E22+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCC
JMFF044J01+ ACG-TTGAACAGATGGTTGCCCGCGCCG
JMFF044P12+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGC
JMFF051H23+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCC
JMFF046B09+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGC
JMFF047D10+ ACGTTTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCC
JMFF044E15+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGC
JMFF045K14+ ACG-TTGAACAGATGG-TGCCCGCGCCGCCGCACT
JMFF045N20+ ACG-TTGAACAGATGG-TGCCCGCGCCGCCGCACTTACCGCCACGCC
JMFF042B20+ ACG-TTGAACAGATGG-TGCCCGCGCCGCCGCAC
JMFF045E10+ ACG-TTGAACAGATGG-TGCCCGCGCCGCCGCACTTACCGCCACGCCGC
JMFF047K19+ ACG-TTGAACAGATGGTT
JMFF042L24+ ACG-TTGAACAGATGGTTGCCCGCGCCG
JMFF044N14+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAG
JMFF051B19+ ACG-TTGAACAGATGG-TGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF047F14+ ACG-TTGAACAGATGG-TGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF049E17+ ACGTTTGAACAGATGG-TGCCCGCGCCGCCGCACTTGCCGCCA
JMFF049D15+ ACGTTTGAAC
JMFF048A07+ ACGTTTGAACAGATGG-TGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF051M14+ ACG-TTGAACAGATGG-TGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF049J11+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF046M14+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF050O02+ ACGTTTGAACAGATGGTTGCCCGCGCCGCCGCACTTA
JMFF049H08+ ACGTTTGAACAGATGGTTGCCGGCGCCGCCGCACTTACCGCC
JMFF050M13+ ACGTTTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF048J06+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF046J20+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGGTCGAC
JMFF048D20+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF051F04+ ACGTTTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGG
JMFF051J01+ ACG-T
JMFF044I08+ ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGGTCGACGAA
                      ____________________________________________________________
consensus ACG-TTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGGTCGACGAA