Previous Contig 001897:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011B23Sequence399001897 (3)gb:AY643519_16191611e-50Acacia mangium CesA1 mRNA, complete cds.714002798 (4)gb:AY162181_15857822e-66Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds.
JMFF037H11Sequence587001897 (3)gb:AY162181_15857822e-82Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds.630002798 (4)gb:AY162181_15857822e-55Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds.
JMFF044H15Sequence647001897 (3)gb:AY162181_15857826e-89Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds.628002798 (4)gb:AY162181_15857822e-44Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044H15+ GAGCATCATCAGCCATTTGTAGCTCTTCTCCATTGATCCTGTCCCCT
                      ____________________________________________________________
consensus GAGCATCATCAGCCATTTGTAGCTCTTCTCCATTGATCCTGTCCCCT
 
. : . : . : . : . : . :
JMFF037H11+ TTTTCTCCTGT
JMFF044H15+ CNAATGTCTCCTTTCCCTTCCGAGTATCTGTTGGTTATNTGAGTCATACTTTTCTCCTGT
                      ____________________________________________________________
consensus CNAATGTCTCCTTTCCCTTCCGAGTATCTGTTGGTTATNTGAGTCATACTTTTCTCCTGT
 
. : . : . : . : . : . :
JMFF037H11+ TTAAGTTTCCAACCTTCTACTCTCTCTTTCCAGTCAACACTACCAAGCCCGTAAGAATTC
JMFF044H15+ NTAAGTTTCCAACCTTCTACTCTCTCTTTCCAGTCAACACTACCAAGCCCGTAAGAATTC
                      ____________________________________________________________
consensus TTAAGTTTCCAACCTTCTACTCTCTCTTTCCAGTCAACACTACCAAGCCCGTAAGAATTC
 
. : . : . : . : . : . :
JMFF037H11+ AAGTCCTTTGAAGGGTCCACAATTCTCACAGGAACTGGTTGCCTCGGGTCAAGGTATGGT
JMFF044H15+ AAGTCCTTTGAAGGGTCCACAATTCTCACAGGAACTGGTTGCCTCGGGTCAAGGTATGGT
                      ____________________________________________________________
consensus AAGTCCTTTGAAGGGTCCACAATTCTCACAGGAACTGGTTGCCTCGGGTCAAGGTATGGT
 
. : . : . : . : . : . :
JMFF037H11+ AGGGAGTGGCCATGCTTGTCTCCGGGGCCCAGAGGTCCTGACATACTTCTTATAGATTGA
JMFF011B23+ CCCAGAGGTCCTGACATACTTCTTATAGATTGA
JMFF044H15+ AGGGAGTGGCCATGCTTGTCTCCGGGGCCCAGAGGTCCTGACATACTTCTTATAGATTGA
                      ____________________________________________________________
consensus AGGGAGTGGCCATGCTTGTCTCCGGGGCCCAGAGGTCCTGACATACTTCTTATAGATTGA
 
. : . : . : . : . : . :
JMFF037H11+ GTATCTGGTGTTGCACTTAGAGGGATTTCACCAGAGATTGGCTGCCCATTTGTCAGAAGA
JMFF011B23+ GTATCTGGTGTTGCACTTAGAGGGATTTCNCCAGAGATTGGCTGCCCATTNGTCAGAAGA
JMFF044H15+ GTATCTGGTGTTGCACTTAGAGGGATTTCACCAGAGATTGGCTGCCCATTTGTCAGAAGA
                      ____________________________________________________________
consensus GTATCTGGTGTTGCACTTAGAGGGATTTCACCAGAGATTGGCTGCCCATTTGTCAGAAGA
 
. : . : . : . : . : . :
JMFF037H11+ GGAATTGGTTGGTGAGATTCATGTCTAGAGGACGAAGAGAGATCAACATCTTCTCCCTGC
JMFF011B23+ GGAATTGGTTGGTGAGATTCATGTCTAGAGGACGAAGAGAGATCAACATCTTCTCCCTGC
JMFF044H15+ GGAATTGGTTGGTGAGATTCATGTCTAGAGGACGAAGAGAGATCAACATCTTCTCCCTGC
                      ____________________________________________________________
consensus GGAATTGGTTGGTGAGATTCATGTCTAGAGGACGAAGAGAGATCAACATCTTCTCCCTGC
 
. : . : . : . : . : . :
JMFF037H11+ CACTTCCGTCTAGCCTTGACATTTCCTTCGCCATAATTGAACTCATTGACAAGGTCGTCA
JMFF011B23+ CACTTCCGTCTAGCCTTGACATTTCCTTCGCCATAATTGAACTCATTGACAAGGTCGTCA
JMFF044H15+ CACTTCCGTCTAGCCTTGACATTTCCTTCGCCATAATTGAACTCATTGACAAGGTCGTCA
                      ____________________________________________________________
consensus CACTTCCGTCTAGCCTTGACATTTCCTTCGCCATAATTGAACTCATTGACAAGGTCGTCA
 
. : . : . : . : . : . :
JMFF037H11+ ACATCCTCCTCCTCATCATCACCGTCAACTCGTGGGCTCCCTTTAAGCCTCTTGTATCGG
JMFF011B23+ ACATCCTCCTCCTCATCATCACCGTCAACTCGTGGGCTCCCTTTAAGCCTCTTGTATCGG
JMFF044H15+ ACATCCTCCTCCTCATCATCACCGTCAACTCGTGGGCTCCCTTTAAGCCTCTTGTATCGG
                      ____________________________________________________________
consensus ACATCCTCCTCCTCATCATCACCGTCAACTCGTGGGCTCCCTTTAAGCCTCTTGTATCGG
 
. : . : . : . : . : . :
JMFF037H11+ GTCTTGCACTGGGGGCATGCTTGGTTCCCATCTTTGCGTTCATACTCATAACAAGTCCGA
JMFF011B23+ GTCTTGCACTGGGGGCATGCTTGGTTCCCATCTTTGCGTTCATACTCATAACAAGTCCGA
JMFF044H15+ GTCTTGCACTGGGGGCATGCTTGGTTCCCATCTTTGCGTTCATACTCATAACAAGTCCGA
                      ____________________________________________________________
consensus GTCTTGCACTGGGGGCATGCTTGGTTCCCATCTTTGCGTTCATACTCATAACAAGTCCGA
 
. : . : . : . : . : . :
JMFF037H11+ CAAACAGGAAAGGCACACTCATTACAAGCAACAAATATATCACCATTAGCAGTCACC
JMFF011B23+ CAAACAGGAAAGGCACACTCATTACAAGCAACAAATATATCACCATTAGCAGTCACC
JMFF044H15+ CAAACAGGAAAGGCACACTCATTACAAGCAACAAATATATCACCATTAGCAGTCACCCGG
                      ____________________________________________________________
consensus CAAACAGGAAAGGCACACTCATTACAAGCAACAAATATATCACCATTAGCAGTCACCCGG