Previous Contig 001879:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001B18Sequence566001879 (12)gb:AY138230_15822721e-04Arabidopsis thaliana CDC26 mRNA, complete cds.678001879 (12)gb:AY138230_15822722e-04Arabidopsis thaliana CDC26 mRNA, complete cds.
JMFF017G12Sequence607001879 (12)gb:AY138230_15822721e-04Arabidopsis thaliana CDC26 mRNA, complete cds.578001879 (12)gb:AY138230_15822721e-04Arabidopsis thaliana CDC26 mRNA, complete cds.
JMFF041D16Sequence599001879 (12)gb:AY138230_15822721e-04Arabidopsis thaliana CDC26 mRNA, complete cds.597001879 (12)gb:AY138230_15822721e-04Arabidopsis thaliana CDC26 mRNA, complete cds.
JMFF044B15Sequence642001879 (12)gb:AY138230_15822722e-04Arabidopsis thaliana CDC26 mRNA, complete cds.640001879 (12)gb:AY138230_15822722e-04Arabidopsis thaliana CDC26 mRNA, complete cds.
JMFN007O12Sequence504001879 (12)gb:AY138230_15822729e-05Arabidopsis thaliana CDC26 mRNA, complete cds.
JMFN029E11Sequence542001879 (12)gb:AY138230_15822721e-04Arabidopsis thaliana CDC26 mRNA, complete cds.
JMSF012P17Sequence289001879 (12)gb:AY138230_15822720.002Arabidopsis thaliana CDC26 mRNA, complete cds.751001879 (12)gb:AY138230_15822720.001Arabidopsis thaliana CDC26 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012P17- AACATTTGAGATGTAAATTATGATAACTCAATGACTTAATAGACATGACTAAATATTA
                      ____________________________________________________________
consensus AACATTTGAGATGTAAATTATGATAACTCAATGACTTAATAGACATGACTAAATATTA
 
. : . : . : . : . : . :
rJMSF012P17- GTGGACACAAAAGATCTGTTTACTTTAAACATAATCATCACACTGTAGCAACTCAGATTT
rJMFF001B18- AATCATCACACTGTAGCAACTCAGATTT
                      ____________________________________________________________
consensus GTGGACACAAAAGATCTGTTTACTTTAAACATAATCATCACACTGTAGCAACTCAGATTT
 
. : . : . : . : . : . :
rJMSF012P17- GAACCTGAACCTTAATCTATTCTGACTAAGGCAGTGCGGACAATTGTTTTGTAATATCAC
rJMFF001B18- GAACCTGAACCTTAATCTATTCTGACTAAGGCAGTGCGGACAATTGTTTTGTAATATCAC
                      ____________________________________________________________
consensus GAACCTGAACCTTAATCTATTCTGACTAAGGCAGTGCGGACAATTGTTTTGTAATATCAC
 
. : . : . : . : . : . :
rJMSF012P17- CTAACGAAACCATCAAGGAGATGAAAACTTGATTTACTAACATTTCAAATATTGCAAAAT
rJMFF001B18- CTAACGAAACCATCAAGGAGATGAAAACTTGATTTACTAACATTTCAAATATTGCAAAAT
JMFN029E11+ TGATTTACTAACATNTCAAATATTGCAAAAT
JMFN007O12+ GCAAAAT
JMFF001B18+ AAACTTGATTTACTAACATTTCAAATATTGCAAAAT
rJMFF044B15- GATGAAAACTTGATTTACTAACATTTCAAATATTGCAAAAT
rJMFF041D16- TGATTTACTAACATTTCAAATATTGCAAAAT
JMFF041D16+ TGATTTACTAACATTTCAAATATTGCAAAAT
JMFF017G12+ TGATTTACTAACATTTCAAATATTGCAAAAT
rJMFF017G12- AATATTGCAAAAT
JMFF044B15+ GATGAAAACTTGATTTACTAACATTTCAAATATTGCAAAAT
                      ____________________________________________________________
consensus CTAACGAAACCATCAAGGAGATGAAAACTTGATTTACTAACATTTCAAATATTGCAAAAT
 
. : . : . : . : . : . :
rJMSF012P17- GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
rJMFF001B18- GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
JMFN029E11+ GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
JMFN007O12+ GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
JMFF001B18+ GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
rJMFF044B15- GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
rJMFF041D16- GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
JMFF041D16+ GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
JMFF017G12+ GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
rJMFF017G12- GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
JMFF044B15+ GGATATTCAATTCGTAGAAAACTACATGAAGGTCTGNCAGGCTCGGCTCTTTAGCATATA
                      ____________________________________________________________
consensus GGATATTCAATTCGTAGAAAACTACATGAAGGTCTTGCAGGCTCGGCTCTTTAGCATATA
 
. : . : . : . : . : . :
rJMSF012P17- TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
rJMFF001B18- TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
JMFN029E11+ TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
JMFN007O12+ TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
JMFF001B18+ TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
rJMFF044B15- TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
rJMFF041D16- TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
JMFF041D16+ TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
JMFF017G12+ TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
rJMFF017G12- TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
JMFF044B15+ TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
                      ____________________________________________________________
consensus TATCCTATCAGAGTTCGAGAAACCAGAAACATGATAGAAATTGTTTTGATTCACTTACTA
 
. : . : . : . : . : . :
rJMSF012P17- AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
rJMFF001B18- AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
JMFN029E11+ AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
JMFN007O12+ AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
JMFF001B18+ AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
rJMFF044B15- AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
rJMFF041D16- AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
JMFF041D16+ AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
JMFF017G12+ AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
rJMFF017G12- AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
JMFF044B15+ AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCNGGATATGTATGATCCATGGC
                      ____________________________________________________________
consensus AAGTTTTTATTTCATGAAAGATTGGAACTTGGAATTCTCTGGATATGTATGATCCATGGC
 
. : . : . : . : . : . :
rJMSF012P17- ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
rJMFF001B18- ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
JMFN029E11+ ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
JMFN007O12+ ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
JMSF012P17+ GGA
JMFF001B18+ ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
rJMFF044B15- ATTCTCCTCCGAGAATTACTTCACCACATATCCCTCAACCTTGGCATACAATTAGGAGGA
rJMFF041D16- ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
JMFF041D16+ ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
JMFF017G12+ ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
rJMFF017G12- ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
JMFF044B15+ ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
                      ____________________________________________________________
consensus ATTCTCCTCCGAGAATTACTTCACCACATATCCATCAACCTTGGCATACAATTAGGAGGA
 
. : . : . : . : . : . :
rJMSF012P17- GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
rJMFF001B18- GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
JMFN029E11+ GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
JMFN007O12+ GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
JMSF012P17+ GAGACCGATGCCGTGGGATTNGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
JMFF001B18+ GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
rJMFF044B15- GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
rJMFF041D16- GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
JMFF041D16+ GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
JMFF017G12+ GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
rJMFF017G12- GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
JMFF044B15+ GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
                      ____________________________________________________________
consensus GAGACCGATGCCGTGGGATTTGGAGGAGGGATCCACGGCGGATCTATCGAAGTGGTGGAG
 
. : . : . : . : . : . :
rJMSF012P17- GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
rJMFF001B18- GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
JMFN029E11+ GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
JMFN007O12+ GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
JMSF012P17+ GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
JMFF001B18+ GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
rJMFF044B15- GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
rJMFF041D16- GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
JMFF041D16+ GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
JMFF017G12+ GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
rJMFF017G12- GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
JMFF044B15+ GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
                      ____________________________________________________________
consensus GAGAGAGGTGGCGCCAGTGGCAGTTGAAGAGGATGTGGAAGTGGTGACGGCAGCAGCAGC
 
. : . : . : . : . : . :
rJMSF012P17- GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTACAAGTTCAACTTTGTCCTCAATTTTGAC
rJMFF001B18- GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
JMFN029E11+ GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
JMFN007O12+ GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
JMSF012P17+ GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTACAAGTTCAACTTTGTCCTCAATTTTGAC
JMFF001B18+ GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
rJMFF044B15- GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
rJMFF041D16- GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
JMFF041D16+ GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
JMFF017G12+ GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
rJMFF017G12- GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
JMFF044B15+ GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
                      ____________________________________________________________
consensus GGCGGCGGCGGCGGCGCGTTTGCGTGCTTCTTCAAGTTCAACTTTGTCCTCAATTTTGAC
 
. : . : . : . : . : . :
rJMSF012P17- TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
rJMFF001B18- TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
JMFN029E11+ TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
JMFN007O12+ TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
JMSF012P17+ TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
JMFF001B18+ TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
rJMFF044B15- TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
rJMFF041D16- TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
JMFF041D16+ TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
JMFF017G12+ TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
rJMFF017G12- TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
JMFF044B15+ TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
                      ____________________________________________________________
consensus TTCGATCTTGCTCGGCCTTCTCCGCAGCATTTCTTCACCGCTCACGAATTCGGTCGCTCG
 
. : . : . : . : . : . :
rJMSF012P17- CAGCAATTTCTTGAGCTANTCTGCTAACCTTTC
rJMFF001B18- CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGT
JMFN029E11+ CAGCAATTTCTTGAGCTAATCTGCTAAACTT
JMFN007O12+ CAGCAATTTCTTGAGCT
JMSF012P17+ CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGT
JMFF001B18+ CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGT
rJMFF044B15- CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGTACTTGACAACTCGTT
rJMFF041D16- CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGTACTTGACAACTCGTT
JMFF041D16+ CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGTACTTGACAACTCGTT
JMFF017G12+ CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGTACTTGACAACTCGTT
rJMFF017G12- CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGTACTTGACAACTCGTT
JMFF044B15+ CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGTACTTGACAACTCGTT
                      ____________________________________________________________
consensus CAGCAATTTCTTGAGCTAATCTGCTAAACTTTCCACTCGAACAGTACTTGACAACTCGTT
 
. : . : . : . : . : . :
rJMFF041D16- GAGCTAACCCGCTTTTAAGGATTTC
JMFF041D16+ GAGCTAACCCGCTTTTAAGGATTTC
JMFF017G12+ GAGCTAACCCGCTTTTAAGGATTTC
rJMFF017G12- GAGCTAACCCGCTTTTAAGGATTTC
JMFF044B15+ GAGCTAACCCGCTTTTAAGGATTTCTCCGGTTACGTTAGGGATAAAATTGCAAATATACT
                      ____________________________________________________________
consensus GAGCTAACCCGCTTTTAAGGATTTCTCCGGTTACGTTAGGGATAAAATTGCAAATATACT