Previous Contig 001875:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043P17Sequence651001875 (12)
JMFS013C08Sequence575001875 (12)
JMFS013G12Sequence578001875 (12)
JMFS035C04Sequence627001875 (12)
JMFS044F08Sequence617001875 (12)
JMFS049F11Sequence579001875 (12)
JMFS050D05Sequence603001875 (12)
JMFS051E05Sequence614001875 (12)
JMFS101E07Sequence615001875 (12)
JMFS120H04Sequence616001875 (12)
JMFS144H02Sequence619001875 (12)
JMFS145F01Sequence615001875 (12)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS050D05+ TAGGAACCTCCCGTTGCTCAACTT
                      ____________________________________________________________
consensus TAGGAACCTCCCGTTGCTCAACTT
 
. : . : . : . : . : . :
JMFS050D05+ TATGGCCATTTGTGCAGGGTTGAAGTTGCTTACCAACCAATGGCCTAGACGCAAGGGTAA
JMFS051E05+ CCATTTGTGCAGGGTTGAAGTTGCTTACCAACCAATGGCCTAGACGCAAGGGTAA
JMFS044F08+ TGAAGTTGCTTACCAACCAATGGCCTAGACGCAAGGGTAN
JMFS101E07+ AACCAATGGCCTAGACGCAAGGGTAA
JMFS035C04+ AAGTTGCTTACCAACCAATGGCCTAGACGCAAGGGTAA
                      ____________________________________________________________
consensus TATGGCCATTTGTGCAGGGTTGAAGTTGCTTACCAACCAATGGCCTAGACGCAAGGGTAA
 
. : . : . : . : . : . :
JMFS050D05+ AGCCTTAACCCGGAGGCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
JMFS051E05+ AGCCTTAACCCGGAGGCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
JMFS044F08+ AGCCTTAACCCGGAGGCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
JMFS101E07+ AGCCTTAACCCGGAGGCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
JMFS035C04+ AGCCTTAACCCGNAGGCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
JMFS013C08+ GCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
JMFS049F11+ GGCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
JMFS013G12+ GCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
                      ____________________________________________________________
consensus AGCCTTAACCCGGAGGCCCAGCAACCCCCCCATGCCAATAGAAATAACATCCTTCCTCTG
 
. : . : . : . : . : . :
JMFS050D05+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS051E05+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS044F08+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS101E07+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS035C04+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS013C08+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS049F11+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS013G12+ CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
JMFS144H02+ GCCTCCCCCGCGTCTCAAT
                      ____________________________________________________________
consensus CTTTGTCGATAATCCGGTGAGCAGCCGTACAAGCTCACTCGGCCTCCCCCGCGTCTCAAT
 
. : . : . : . : . : . :
JMFS050D05+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS051E05+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS044F08+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS101E07+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS035C04+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS013C08+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS049F11+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS013G12+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS144H02+ CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS120H04+ GGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFS145F01+ ACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
JMFF043P17+ CGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
                      ____________________________________________________________
consensus CTGGGGGAACGGGGACATGATATCATGCACCGGCTCCGTATCATCCAACTCCTCGGGGTC
 
. : . : . : . : . : . :
JMFS050D05+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS051E05+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS044F08+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS101E07+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS035C04+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS013C08+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS049F11+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS013G12+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS144H02+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS120H04+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFS145F01+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
JMFF043P17+ ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
                      ____________________________________________________________
consensus ACGAGGGGGGGTGGGGGCCTCGTCATCCACATCGGTCCCATCGTCACTTAAAATGATTGG
 
. : . : . : . : . : . :
JMFS050D05+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS051E05+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS044F08+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS101E07+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS035C04+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS013C08+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS049F11+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS013G12+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS144H02+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS120H04+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFS145F01+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
JMFF043P17+ TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
                      ____________________________________________________________
consensus TTGTCTAGCATCAGCCCCTGAATGATCAAGTTGGAGCGCCGCCTGACGCCGGGCTGCGAC
 
. : . : . : . : . : . :
JMFS050D05+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS051E05+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS044F08+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS101E07+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS035C04+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS013C08+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS049F11+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS013G12+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS144H02+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS120H04+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFS145F01+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
JMFF043P17+ CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
                      ____________________________________________________________
consensus CCTAGCTGCTATGCCGGACGCAGACAGAACCCCACTGCCGGACCGGCGTTTAAACGGCCG
 
. : . : . : . : . : . :
JMFS050D05+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS051E05+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCAATGAA
JMFS044F08+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS101E07+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS035C04+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS013C08+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS049F11+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS013G12+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS144H02+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS120H04+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFS145F01+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
JMFF043P17+ TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
                      ____________________________________________________________
consensus TGTCACCGGCAACACTGGCTGACCCGCCACCCTCCTCCTCGAACCCCGCGCGCCACTGAA
 
. : . : . : . : . : . :
JMFS050D05+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS051E05+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS044F08+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS101E07+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS035C04+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS013C08+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS049F11+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS013G12+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS144H02+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS120H04+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFS145F01+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
JMFF043P17+ TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
                      ____________________________________________________________
consensus TCTAGCCATCACGAGCTTGTGAATGCACGGCGTTGCTTGTTATCTTTGATTACACCGGAG
 
. : . : . : . : . : . :
JMFS050D05+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATT
JMFS051E05+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS044F08+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS101E07+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS035C04+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS013C08+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS049F11+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS013G12+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS144H02+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS120H04+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFS145F01+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
JMFF043P17+ CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
                      ____________________________________________________________
consensus CGAACGTTCTTGAGCATCCTTGTTCTAGCCAAAACCATTTCTAAGCTCATCTCCTTAGCT
 
. : . : . : . : . : . :
JMFS051E05+ TTATCTTC
JMFS044F08+ TTATCTTCTTCCACCATTTCCATCTCTCAAG
JMFS101E07+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAA
JMFS035C04+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAA
JMFS013C08+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAAC
JMFS049F11+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAACAAA
JMFS013G12+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAACAAA
JMFS144H02+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAACAAACACATCT
JMFS120H04+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAACAAACACATCT
JMFS145F01+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAACAAACACATCT
JMFF043P17+ TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAACAAACACATCT
                      ____________________________________________________________
consensus TTATCTTCTTCCACCATTTCCATCTCTCAAGCAACCACAACAACCCAAACAAACACATCT
 
. : . : . : . : . : . :
JMFS144H02+ AGCTTAGATAATCTCATCAAAGGAAATAAGCTAACCAAAGGAAATGGGAGAAGATATCTT
JMFS120H04+ AGCTTAGATAATCTCATCAAAGGAAATAAGCTAACCAAAGGAAATGGGAGAAGATATCTT
JMFS145F01+ AGCTTAGATAATCTCATCAAAGGAAATAAGCTAACCAAAGGAAATGGGAGAAGATATCTT
JMFF043P17+ AGCTTAGATAATCTCATCAAAGGAAATAAGCTAACCAAAGGAAATGGGAGAAGATATCTT
                      ____________________________________________________________
consensus AGCTTAGATAATCTCATCAAAGGAAATAAGCTAACCAAAGGAAATGGGAGAAGATATCTT
 
. : . : . : . : . : . :
JMFS144H02+ ACCAAGTCTTGAAACCTAAGCTTGGGAAGAAGAAGAAGCTCCAAAAATGAAGAAGATGAA
JMFS120H04+ ACCAAGTCTTGAAACCTAAGCTTGGGAAGAAGAAGAAGCTCCAAAAATGAAGAAGATGAA
JMFS145F01+ ACCAAGTCTTGAAACCTAAGCTTGGGAAGAAGAAGAAGCTCCAAAAATGAAGAAGATGAA
JMFF043P17+ ACCAAGTCTTGAAACCTAAGCTTGGGAAGAAGAAGAAGCTCCAAAAATGAAGAAGATGAA
                      ____________________________________________________________
consensus ACCAAGTCTTGAAACCTAAGCTTGGGAAGAAGAAGAAGCTCCAAAAATGAAGAAGATGAA
 
. : . : . : . : . : . :
JMFS120H04+ GATGATGGGGAGAGAGGGA
JMFS145F01+ GATGATGGGGAGAGAGGGAGGATGTCACG
JMFF043P17+ GATGATGGGGAGAGAGGGAGGATGTCACGATGAGAGCTGCTGATTTTGGAGAAAATCGGT
                      ____________________________________________________________
consensus GATGATGGGGAGAGAGGGAGGATGTCACGATGAGAGCTGCTGATTTTGGAGAAAATCGGT