Previous Contig 001871:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043O17Sequence642001871 (2)gb:AB008270_15104844e-30Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTG13.>gb:BT011691_1641657010370 (2)gb:AC105364_17379721e-45Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se
JMFF047J15Sequence641001871 (2)gb:AB008270_15104844e-30Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTG13.>gb:BT011691_1641534010370 (2)gb:AC105364_17379725e-32Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete se

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047J15+ TGCAAGTAGAGAGTGGCCAAAC-GGTTAAGTGTTAATAGACG
JMFF043O17+ TGCAAGTAGAGAGTGGCCAAACGGGTTAAGTGTTAATAGACG
                      ____________________________________________________________
consensus TGCAAGTAGAGAGTGGCCAAACGGGTTAAGTGTTAATAGACG
 
. : . : . : . : . : . :
JMFF047J15+ GCGGCAGAGGACCGGAGAAGTTATTGTGGGCGAGATTGAGGCGAATGAGGTTCGGTAAGG
JMFF043O17+ GCGGCAGAGGACCGGAGAAGTTATTGTGGGCGAGATTGAGGCGAATGAGGTTCGGTAAGG
                      ____________________________________________________________
consensus GCGGCAGAGGACCGGAGAAGTTATTGTGGGCGAGATTGAGGCGAATGAGGTTCGGTAAGG
 
. : . : . : . : . : . :
JMFF047J15+ AGAAAACGGCGTCGGGGATTTGGCCGGAGAAGAAGTTGTGCTGAAGATAAACGTTTCTGA
JMFF043O17+ AGAAAACGGCGTCGGGGATTTGGCCGGAGAAGAAGTTGTGCTGAAGATAAACGTTTCTGA
                      ____________________________________________________________
consensus AGAAAACGGCGTCGGGGATTTGGCCGGAGAAGAAGTTGTGCTGAAGATAAACGTTTCTGA
 
. : . : . : . : . : . :
JMFF047J15+ GGTCGCGTAGCGAGGAGAAAATGTCAGGCGGGAGCGGACCGGAGAGAGCATTGTACCGGA
JMFF043O17+ GGTCGCGTAGCGAGGAGAAAATGTCAGGCGGGAGCGGACCGGAGAGAGCATTGTACCGGA
                      ____________________________________________________________
consensus GGTCGCGTAGCGAGGAGAAAATGTCAGGCGGGAGCGGACCGGAGAGAGCATTGTACCGGA
 
. : . : . : . : . : . :
JMFF047J15+ GACTAAGCGTCTGAAGGCCGGTGAGATTTCCGATACTCCCCGGCGGGATTTTCCCGGAGA
JMFF043O17+ GACTAAGCGTCTGAAGGCCGGTGAGATTTCCGATACTCCCCGGCGGGATTTTCCCGGAGA
                      ____________________________________________________________
consensus GACTAAGCGTCTGAAGGCCGGTGAGATTTCCGATACTCCCCGGCGGGATTTTCCCGGAGA
 
. : . : . : . : . : . :
JMFF047J15+ GACCCATTCCGGGGAGGTGAAGCTCCACAACGAATTTCCTGTCGGAGGAGCACTGAACCC
JMFF043O17+ GACCCATTCCGGGGAGGTGAAGCTCCACAACGAATTTCCTGTCGGAGGAGCACTGAACCC
                      ____________________________________________________________
consensus GACCCATTCCGGGGAGGTGAAGCTCCACAACGAATTTCCTGTCGGAGGAGCACTGAACCC
 
. : . : . : . : . : . :
JMFF047J15+ CCGGCCAAGAACACGCATTCGGCTCCGACAAGTTCCAGAGAAGAGCGCGGCCGCCCACGG
JMFF043O17+ CCGGCCAAGAACACGCATTCGGCTCCGACAAGTTCCAGAGAAGAGCGCGGCCGCCCACGG
                      ____________________________________________________________
consensus CCGGCCAAGAACACGCATTCGGCTCCGACAAGTTCCAGAGAAGAGCGCGGCCGCCCACGG
 
. : . : . : . : . : . :
JMFF047J15+ CGGATCGGAGCGCCAAGAGCGCGGCGCGGTCGGCGGCGAGGTCAGCCGTCGTCGTGGGTG
JMFF043O17+ CGGATCGGAGCGCCAAGAGCGCGGCGCGGTCGGCGGCGAGGTCAGCCGTCGTCGTGGGTG
                      ____________________________________________________________
consensus CGGATCGGAGCGCCAAGAGCGCGGCGCGGTCGGCGGCGAGGTCAGCCGTCGTCGTGGGTG
 
. : . : . : . : . : . :
JMFF047J15+ CGAGGAGGGAGAAGAAGAAGATGGAAATGGCGGCGAAGCAGCAGAAGACGAATTGAAACC
JMFF043O17+ CGAGGAGGGAGAAGAAGAAGATGGAAATGGCGGCGAAGCAGCAGAAGACGAATTGAAACC
                      ____________________________________________________________
consensus CGAGGAGGGAGAAGAAGAAGATGGAAATGGCGGCGAAGCAGCAGAAGACGAATTGAAACC
 
. : . : . : . : . : . :
JMFF047J15+ TCATTTTCATAGTACAAACGTCGGAAAACTCGAAAAAAAATCTTAATTTTGTCGATTTTC
JMFF043O17+ TCATTTTCATAGTACAAACGTCGGAAAACTCGAAAAAAAATCTTAATTTTGTCGATTTTC
                      ____________________________________________________________
consensus TCATTTTCATAGTACAAACGTCGGAAAACTCGAAAAAAAATCTTAATTTTGTCGATTTTC
 
. : . : . : . : . : . :
JMFF047J15+ TAGGCGACGCTAGTGTTCTGTCTGGATTGCTGGCTAGAAAGGAGTGGGCTTCATGTTCTT
JMFF043O17+ TAGGCGACGCTAGTGTTCTGTCTGGATTGCTGGCTAGAAAGGAGTGGGCTTCATGTTCTT
                      ____________________________________________________________
consensus TAGGCGACGCTAGTGTTCTGTCTGGATTGCTGGCTAGAAAGGAGTGGGCTTCATGTTCTT