Previous Contig 001870:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C09Sequence420001870 (4)gb:AX078761_14607060.008Sequence 2 from Patent WO0105951.>gb:AB025633_1516593 Arabidopsis thaliana genom764010369 (2)gb:AF542974_18102363e-37Triticum aestivum Emr1 mRNA, complete cds.
JMFF043O16Sequence672001870 (4)gb:AX078761_14607068e-05Sequence 2 from Patent WO0105951.>gb:AB025633_1516593 Arabidopsis thaliana genom508010369 (2)gb:AK011768_11565850.007Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library,
JMFS053D03Sequence164001870 (4)
JMFS149A02Sequence624001870 (4)gb:AX078761_14607063e-05Sequence 2 from Patent WO0105951.>gb:AB025633_1516593 Arabidopsis thaliana genom

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043O16+ AAGAAACTCTTC
                      ____________________________________________________________
consensus AAGAAACTCTTC
 
. : . : . : . : . : . :
JMFS149A02+ TGTCATCGAGCAAATCCTCATCTTCATCATCTTCCTCTTCTTCATTCTTCATAGT
JMFF043O16+ ATCACTGTCATCGAGCAAATCCTCATCTTCATCATCTTCCTCTTCTTCATTCTTCATAGT
                      ____________________________________________________________
consensus ATCACTGTCATCGAGCAAATCCTCATCTTCATCATCTTCCTCTTCTTCATTCTTCATAGT
 
. : . : . : . : . : . :
JMFS149A02+ TACAGTCTCCACTGCAGCAGGATGGGTTTGGTTATTTTCAATCTTTCTGAGGCCATCTTC
JMFF043O16+ TACAGTCTCCACTGCAGCAGGATGGGTTTGGTTATTTTCAATCTTTCTGAGGCCATCTTC
                      ____________________________________________________________
consensus TACAGTCTCCACTGCAGCAGGATGGGTTTGGTTATTTTCAATCTTTCTGAGGCCATCTTC
 
. : . : . : . : . : . :
JMFS149A02+ AGAGGAAGGATTTGAGGCTACTCTACTAGACCAATTCCATCCATGTTGTAGAGGAGGTGG
JMFF043O16+ AGAGGAAGGATTGNAGGCTACTCTACTAGACCAATTCCATCCATGTTGTAGAGGAGGTGG
                      ____________________________________________________________
consensus AGAGGAAGGATTTGAGGCTACTCTACTAGACCAATTCCATCCATGTTGTAGAGGAGGTGG
 
. : . : . : . : . : . :
JMFS149A02+ AATTGCGGGAGGAAACCTTGCATTATCTCTACCTCCACTTGAAGGTCTTCTAGAATCTGT
JMFF003C09+ AATCTGT
JMFF043O16+ AATTGCGGGAGGAAACCTTGCATTATCTCTACCTCCACTTGAAGGTCTTCTAGAATCTGT
                      ____________________________________________________________
consensus AATTGCGGGAGGAAACCTTGCATTATCTCTACCTCCACTTGAAGGTCTTCTAGAATCTGT
 
. : . : . : . : . : . :
JMFS149A02+ ACTGCTGACAGAACCCCTTCCTGACCCACCATTATTCCAGGCTTTATGACCTGAACTTCC
JMFF003C09+ ACTGCTGACAGAACCCCTTCCTGACCCACCATTATTCCAGGCTTTATGACCTGAACTTCC
JMFF043O16+ ACTGCTGACAGAACCCCTTCCTGACCCACCATTATTCCAGGGTTTATGACCTGAACTTCC
                      ____________________________________________________________
consensus ACTGCTGACAGAACCCCTTCCTGACCCACCATTATTCCAGGCTTTATGACCTGAACTTCC
 
. : . : . : . : . : . :
JMFS149A02+ CCATGCATTGCCAGTGGAAACAGCAGCAGAGTTTTGGGGAACATACTGTCTCCCCCCACT
JMFF003C09+ CCATGCATTGCCAGTGGAAACAGCAGCAGAGTTTTGGGGAACATACTGTCTCCCCCCACT
JMFF043O16+ CCATGCATTGCCAGTGGAAACAGCAGCAGAGTTTTGGGGAACATACTGTCTCCCCCCACT
                      ____________________________________________________________
consensus CCATGCATTGCCAGTGGAAACAGCAGCAGAGTTTTGGGGAACATACTGTCTCCCCCCACT
 
. : . : . : . : . : . :
JMFS149A02+ GGTTCCAGCCTTGTTCTTCGACTTCTTACCATAAACCTCCCATCCATCACCTTGTGCTGA
JMFS053D03+ TTCCAGCCTTGTTCTTCGACTTCTTACCATAAACCTCCCATCCATCACCTTGTGCTGA
JMFF003C09+ GGTTCCAGCCTTGTTCTTCGACTTCTTACCATAAACCTCCCATCCATCACCTTGTGCTGA
JMFF043O16+ GGTTCCAGCCTTGTTCTTCGACTTCTTACCATAAACCTCCCATCCATCACCTTGTGCTGA
                      ____________________________________________________________
consensus GGTTCCAGCCTTGTTCTTCGACTTCTTACCATAAACCTCCCATCCATCACCTTGTGCTGA
 
. : . : . : . : . : . :
JMFS149A02+ ATGTACGGTCATATCTGGCACTGAAGGATAGGTACTCGAACCAGAAGCTTGCTTACCCCC
JMFS053D03+ ATGTACGGTCATATCTGGCACTGAAGGATAGGTACTCGAACCAGAAGCTTGCTTACCCCC
JMFF003C09+ ATGTACGGTCATATCTGGCACTGAAGGATAGGTACTCGAACCAGAAGCTTGCTTACCCCC
JMFF043O16+ ATGTACGGTCATATCTGGCACTGAAGGATAGGTACTCGAACCAGAAGCTTGCTTACCCCC
                      ____________________________________________________________
consensus ATGTACGGTCATATCTGGCACTGAAGGATAGGTACTCGAACCAGAAGCTTGCTTACCCCC
 
. : . : . : . : . : . :
JMFS149A02+ TTTAGTCGAACTCATCATTAAACAATTGCACAGAAGAGACCCGAAAGCAGCGAAATGAAA
JMFS053D03+ TTTAGTCGAACTCATCATTAAACAATTGCACAGAAGA
JMFF003C09+ TTTAGTCGAACTCATCATTAAACAATTGCACAGAAGAGACCCGAAAGCAGCGAAATGAAA
JMFF043O16+ TTTAGTCGAACTCATCATTAAACAATTGCACAGAAGAGACCCGAAAGCAGCGAAATGAAA
                      ____________________________________________________________
consensus TTTAGTCGAACTCATCATTAAACAATTGCACAGAAGAGACCCGAAAGCAGCGAAATGAAA
 
. : . : . : . : . : . :
JMFS149A02+ GCGTTATCCAGGCAAGATCGTCGATCGCCGATCGCCGCTGGTGAGGTAGCAGAGTCGTAG
JMFF003C09+ GCGTTATCCAGGCAAGATCGTCGATCGCCGATCGCCGCTGGTGAGGTAGCAGAGTCGTAG
JMFF043O16+ GCGTTATCCAGGCAAGATCGTCGATCGCCGATCGCCGCTGGTGAGGTAGCAGAGTCGTAG
                      ____________________________________________________________
consensus GCGTTATCCAGGCAAGATCGTCGATCGCCGATCGCCGCTGGTGAGGTAGCAGAGTCGTAG
 
. : . : . : . : . : . :
JMFS149A02+ TGAGAGAGTGAGAGTTGCAGTGAGACTGT
JMFF003C09+ TGAGAGAGTGAGAGTTGCAGTGAGACTGTGAGAGAGAAAAAGTTTGGCAAAAG
JMFF043O16+ TGAGAGAGTGAGAGTTGCAGTGAGACTGTGAGAGAGAAAAAGTTTGGCAAAAGCCAGAAC
                      ____________________________________________________________
consensus TGAGAGAGTGAGAGTTGCAGTGAGACTGTGAGAGAGAAAAAGTTTGGCAAAAGCCAGAAC