Previous Contig 001869:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038L04Sequence561001869 (26)pir|T09846|T098461e-90phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761744010008 (5)gb:CSA417435_16738315e-86Cucumis sativus partial mRNA for phosphoenolpyruvate carboxylase (pepc1 gene).
JMFF043O03Sequence639001869 (26)gb:AF248080_17806298e-52Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.287010008 (5)gb:AF459644_18017293e-09Lupinus albus phosphoenolpyruvate carboxylase (PEPC1) mRNA, complete cds.
JMFS008A01Sequence626001869 (26)gb:AF248080_17806291e-54Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS009H04Sequence566001869 (26)pir|T09846|T09846e-102phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS018A07Sequence613001869 (26)gb:AF248080_17806294e-53Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS030E06Sequence150001869 (26)gb:SRO286750_17224261e-07Sesbania rostrata mRNA for phosphoenolpyruvate carboxylase (pepc gene).
JMFS049A02Sequence624001869 (26)pir|T09846|T098463e-97phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS051D06Sequence612001869 (26)pir|T09846|T098462e-63phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS063H06Sequence627001869 (26)gb:AF248080_17806294e-54Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS066D03Sequence626001869 (26)pir|T09846|T098469e-98phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS082D06Sequence622001869 (26)gb:AF248080_17806291e-54Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS082D07Sequence622001869 (26)gb:AF248080_17806294e-54Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS088B01Sequence621001869 (26)pir|T09846|T098463e-97phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS090A10Sequence627001869 (26)gb:AF248080_17806291e-53Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS098H08Sequence627001869 (26)gb:AF248080_17806299e-53Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS102C09Sequence625001869 (26)pir|T09846|T098468e-99phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS115F07Sequence625001869 (26)gb:AF248080_17806299e-53Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS116G12Sequence587001869 (26)pir|T09846|T09846e-100phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMFS118E01Sequence627001869 (26)gb:AF248080_17806299e-53Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS122C08Sequence581001869 (26)gb:AF248080_17806299e-49Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS127B08Sequence469001869 (26)gb:AF248080_17806297e-16Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS140D06Sequence615001869 (26)gb:AF248080_17806294e-55Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS146E04Sequence629001869 (26)gb:AF248080_17806294e-56Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS146H02Sequence627001869 (26)gb:AF248080_17806292e-52Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds.
JMFS167F11Sequence619001869 (26)pir|T09846|T09846e-107phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761
JMSF042B12Sequence637001869 (26)pir|T09846|T098463e-96phosphoenolpyruvate carboxylase (EC 4.1.1.31) 1 - upland cotton>gb:AF008939_1761625010008 (5)sp|Q9MAH0|CAPP_ARATH1e-77Phosphoenolpyruvate carboxylase (EC 4.1.1.31) (PEPCase).>pir|D96573|D96573 prote

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS009H04+ CCGCAAGCACATAATGATCTGTAGCAC
                      ____________________________________________________________
consensus CCGCAAGCACATAATGATCTGTAGCAC
 
. : . : . : . : . : . :
JMFS009H04+ AGCTCAAGCGGCTCCAGAAACTGTTCAACATTGGTGAATGTTGTCTCTTCGGGAATATCA
                      ____________________________________________________________
consensus AGCTCAAGCGGCTCCAGAAACTGTTCAACATTGGTGAATGTTGTCTCTTCGGGAATATCA
 
. : . : . : . : . : . :
JMFS009H04+ GAGTACCCATTTGCAAGTAACTGACGAGCACGCTCCCGAGTACTATACAGCTTGTCTCTA
                      ____________________________________________________________
consensus GAGTACCCATTTGCAAGTAACTGACGAGCACGCTCCCGAGTACTATACAGCTTGTCTCTA
 
. : . : . : . : . : . :
JMFS009H04+ ACATCAGCAAGAACAACTCGGTAAGGCTCATTTGGGGGAATTTGCTTCCAAAATTCAATA
                      ____________________________________________________________
consensus ACATCAGCAAGAACAACTCGGTAAGGCTCATTTGGGGGAATTTGCTTCCAAAATTCAATA
 
. : . : . : . : . : . :
JMFS009H04+ TAATGTTTGACGTCTCTTTTTGAGGTCCTATGGAGTTCATCTGCACGAGCACGCAATTCA
                      ____________________________________________________________
consensus TAATGTTTGACGTCTCTTTTTGAGGTCCTATGGAGTTCATCTGCACGAGCACGCAATTCA
 
. : . : . : . : . : . :
JMFS009H04+ TCATTGCAGCGCCACATTGAAAGCTCAAACATAAGATCTTCAATCTGAGAGAAGTAGACA
                      ____________________________________________________________
consensus TCATTGCAGCGCCACATTGAAAGCTCAAACATAAGATCTTCAATCTGAGAGAAGTAGACA
 
. : . : . : . : . : . :
JMFS009H04+ TTAGCAGCCATCATTCTAGCCAATAAGCATACATCCCTTGTAACTTCAGGTGTCACTCTG
JMFS116G12+ CCTTGTAACTTCAGGTGTCACTCTG
JMFS167F11+ AGCCAATAAGCATACATCCCTTGTAACTTCAGGTGTCACTCTG
                      ____________________________________________________________
consensus TTAGCAGCCATCATTCTAGCCAATAAGCATACATCCCTTGTAACTTCAGGTGTCACTCTG
 
. : . : . : . : . : . :
JMFS009H04+ GGGTTGCCATCTCGATCCCCGCCCATCCAAGAAGAAAATTGGATAAGAGGAGCATTGTAA
JMFS116G12+ GGGTTGCCATCTCGATCNCCGCCCATCCAAGAAGAAAATTGGATAAGAGGAGCATTGTAA
JMFS167F11+ GGGTTGCCATCTCGATCCCCGCCCATCCAAGAAGAAAATTGGATAAGAGGAGCATTGTAA
                      ____________________________________________________________
consensus GGGTTGCCATCTCGATCCCCGCCCATCCAAGAAGAAAATTGGATAAGAGGAGCATTGTAA
 
. : . : . : . : . : . :
JMFS009H04+ GGAACACGCTCATCTATTCCAATATTCTTCAAAGCAGTGTCAACTCGACGCAAGAACTTT
JMFS116G12+ GGAACACGCTCATCTATTCCAATATTCTTCAAAGCAGTGTCAACTCGACGCAAGAACTTT
JMFS167F11+ GGAACACGCTCATCTATTCCAATATTCTTCAAAGCAGTGTCAACTCGACGCAAGAACTTT
JMFF038L04+ TCTTCAAAGCAGTGTCAACTCGACGCAAGAACTTT
                      ____________________________________________________________
consensus GGAACACGCTCATCTATTCCAATATTCTTCAAAGCAGTGTCAACTCGACGCAAGAACTTT
 
. : . : . : . : . : . :
JMFS009H04+ GGCACTCCCTTCCATATTGTCTCATGGAAGTAACTCATTCCAGCCCTCATCTCATCTTG
JMFS116G12+ GGCACTCCCTTCCATATTGTCTCATGGAAGTAACTCATTCCAGCACTCATCTCATCTTGT
JMFS167F11+ GGCACTCCCTTCCATATTGTCTCATGGAAGTAACTCATTCCAGCCCTCATCTCATCTTGT
JMFF038L04+ GGCACTCCCTTCCATATTGTCTCATGGAAGTAACTCATTCCAGCCCTCATCTCATCTTGT
                      ____________________________________________________________
consensus GGCACTCCCTTCCATATTGTCTCATGGAAGTAACTCATTCCAGCCCTCATCTCATCTTGT
 
. : . : . : . : . : . :
JMFS116G12+ GGAGTTGGTGGACTCCTCTTGATTTCATCTGTGCGAAATGCAGCTTGTATCTCTCTCTGT
JMFS167F11+ GGAGTTGGTGGACTCCTCTTGATTTCATCTGTGCGAAATGCAGCTTGTATCTCTCTCTGT
JMFF038L04+ GGAGTTGGTGGACTCCTCTTGATTTCATCTGTGCGAAATGCAGCTTGTATCTCTCTCTGT
JMFS102C09+ TGTGCGAAATGCAGCTTGTATCTCTCTCTGT
JMSF042B12+ TCTGT
                      ____________________________________________________________
consensus GGAGTTGGTGGACTCCTCTTGATTTCATCTGTGCGAAATGCAGCTTGTATCTCTCTCTGT
 
. : . : . : . : . : . :
JMFS116G12+ AAAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
JMFS167F11+ AAAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
JMFF038L04+ AAAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
JMFS102C09+ AAAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
JMFS088B01+ CTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
JMFS066D03+ AAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
JMFS049A02+ AAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
JMSF042B12+ AAAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
                      ____________________________________________________________
consensus AAAGCCTCATCAAGCTCATGCTTATCATCAGGAGTGATATCTTTGGCATACAATTGTGTC
 
. : . : . : . : . : . :
JMFS116G12+ AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
JMFS167F11+ AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
JMFF038L04+ AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
JMFS102C09+ AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
JMFS088B01+ AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
JMFS066D03+ AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
JMFS049A02+ AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
JMSF042B12+ AAACAAT---GGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGGCTGAGTAGGG
                      ____________________________________________________________
consensus AAACAATCTCGGATCCTTCCATGCTTTTGAAGCAAAGATCTGCGAACAGACTGAGTAGGG
 
. : . : . : . : . : . :
JMFS116G12+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
JMFS167F11+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
JMFF038L04+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
JMFS102C09+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
JMFS088B01+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
JMFS066D03+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
JMFS049A02+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
JMSF042B12+ TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
                      ____________________________________________________________
consensus TGCGCTGTTAGGACCAAATCTATCGTCTGGTTCTTCAGAGCATCAAAGACTTCTTGAGGG
 
. : . : . : . : . : . :
JMFS116G12+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMFS167F11+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMFF038L04+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMFS102C09+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMFS088B01+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMFS066D03+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMFS049A02+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMSF042B12+ GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
JMFS051D06+ ACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTG
JMFS146E04+ GTTGTT
                      ____________________________________________________________
consensus GACTTGTTAAGTTGTCCAACAAGCCTCCTTAGAGTCTCTTCGATATCCGATTCAGTTGTT
 
. : . : . : . : . : . :
JMFS116G12+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS167F11+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFF038L04+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS102C09+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS088B01+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS066D03+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS049A02+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMSF042B12+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS051D06+ NCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS140D06+ CAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS146E04+ GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS082D06+ TGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS018A07+ ATCAGACAAGTCGCATTTTTTTAACTGGCTCCTACGCCTGTAGGCTATC
JMFS082D07+ TGCCTCATCAGACAAGTCGCATTTTTTTAACTGGCTCCTACGCCTGTAGGCTATC
JMFS122C08+ TGTAGGCTATC
JMFS008A01+ ATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS063H06+ CTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS090A10+ CATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS115F07+ CAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS098H08+ GACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS118E01+ AAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFS146H02+ TTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
JMFF043O03+ TTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
                      ____________________________________________________________
consensus GCAGATGCCTCATCAGACAAGTCGCATTTTTTTAACTTGCTCCTACGCCTGTAGGCTATC
 
. : . : . : . : . : . :
JMFS116G12+ TGAACCTCCTCAGCAAGGTTGG
JMFS167F11+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATG
JMFF038L04+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS102C09+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS088B01+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS066D03+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS049A02+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMSF042B12+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS051D06+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS140D06+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS146E04+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS082D06+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS018A07+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS082D07+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS122C08+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS008A01+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS063H06+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS090A10+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS115F07+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS098H08+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS118E01+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFS146H02+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
JMFF043O03+ TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
                      ____________________________________________________________
consensus TGAACCTCCTCAGCAAGGTTGGCCAAGTTAAGCATGTTGGAAAAAGCTTTGGTAACCACA
 
. : . : . : . : . : . :
JMFF038L04+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGC
JMFS102C09+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS088B01+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS066D03+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS049A02+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMSF042B12+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS051D06+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS140D06+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS146E04+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS082D06+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS018A07+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS082D07+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS122C08+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS008A01+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS063H06+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS090A10+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS115F07+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS098H08+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS118E01+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFS146H02+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
JMFF043O03+ ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
                      ____________________________________________________________
consensus ATAGAATCCCCAGCATCCAAACTAGTAATGACTCTCCCAAGCTCTTCCAGCTTTTGAGTA
 
. : . : . : . : . : . :
JMFS102C09+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS088B01+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS066D03+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS049A02+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMSF042B12+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS051D06+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS140D06+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS146E04+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS082D06+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS018A07+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS082D07+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS122C08+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS008A01+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS063H06+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS090A10+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS115F07+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS098H08+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS118E01+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS146H02+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
JMFS127B08+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCAGGAATG
JMFF043O03+ TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
                      ____________________________________________________________
consensus TCACGCTTCCCTTCATACTCTGCAGAGAGCTCATAACACTCTTGGACCGTCTCACGAATG
 
. : . : . : . : . : . :
JMFS102C09+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS088B01+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS066D03+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS049A02+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMSF042B12+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS051D06+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS140D06+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS146E04+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS082D06+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS018A07+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS082D07+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS122C08+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS008A01+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS063H06+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS090A10+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS115F07+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS098H08+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS118E01+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS146H02+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS127B08+ CCTTCACCATGCAAATCCTGCAGGATATCCAGTAAGCGATCAAGCAAGAGCGCGTCGTAC
JMFS030E06+ CGTAC
JMFF043O03+ CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
                      ____________________________________________________________
consensus CCTTCACCATGCAAATCCTGCAGGATATCCAGAAAGCGATCAAGCAAGAGCGCGTCGTAC
 
. : . : . : . : . : . :
JMFS102C09+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGC
JMFS088B01+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS066D03+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS049A02+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMSF042B12+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS051D06+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS140D06+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS146E04+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS082D06+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS018A07+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS082D07+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS122C08+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS008A01+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS063H06+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS090A10+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS115F07+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS098H08+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS118E01+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS146H02+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS127B08+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFS030E06+ TCCACGAGCTTGTCATCCTCCAAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
JMFF043O03+ TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
                      ____________________________________________________________
consensus TCCACGAGCTTGTCATCCTCCGAGACCTTCGCAGGAGCCAGTAGCCTCAGCTGCGCGTCA
 
. : . : . : . : . : . :
JMFS088B01+ ATCGACGCCATCTTCTCAAGATTCCT
JMFS066D03+ ATCGACGCCATCTTCTCAAGATTCCTA
JMFS049A02+ ATCGACGCCATCTTCTCAAGATTCC
JMSF042B12+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTC
JMFS051D06+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS140D06+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS146E04+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS082D06+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS018A07+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS082D07+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS122C08+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS008A01+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS063H06+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS090A10+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS115F07+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS098H08+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS118E01+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS146H02+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS127B08+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFS030E06+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
JMFF043O03+ ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
                      ____________________________________________________________
consensus ATCGACGCCATCTTCTCAAGATTCCTACTCATTCTCCTTATCACCGGTGGGGTAGAAAAA
 
. : . : . : . : . : . :
JMFS051D06+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS140D06+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS146E04+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS082D06+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS018A07+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS082D07+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS122C08+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS008A01+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS063H06+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS090A10+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS115F07+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS098H08+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS118E01+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS146H02+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
JMFS127B08+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTATCCTTTCTCACCCA
JMFS030E06+ GGGTACACGAGAATTCAGCTGATTG
JMFF043O03+ GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
                      ____________________________________________________________
consensus GGGTACACGAGAATTCAGCTGATTGGTTCCTCTAGACGCTTCTTTCTCCTTTCTCACCCA
 
. : . : . : . : . : . :
JMFS051D06+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS140D06+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS146E04+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS082D06+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS018A07+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS082D07+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS122C08+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS008A01+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS063H06+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS090A10+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS115F07+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS098H08+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS118E01+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS146H02+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
JMFS127B08+ ACAATCACGCAGAGAAAAACTGGGTCTTTCTCGGTTTGAAGATTGACCCCTGACAAATTA
JMFF043O03+ ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
                      ____________________________________________________________
consensus ACAATCACGCAGAGAAAAACTGGGTCTTTCACGGTTTGAAGATTGACCCCTGACAAATTA
 
. : . : . : . : . : . :
JMFS051D06+ GCGATTATATAGG
JMFS140D06+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS146E04+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS082D06+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS018A07+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS082D07+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS122C08+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS008A01+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS063H06+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS090A10+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS115F07+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS098H08+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS118E01+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS146H02+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFS127B08+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
JMFF043O03+ GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTG
                      ____________________________________________________________
consensus GCGATTATATAGGTGTCCCCCCCGATTGTCACGAAAGAAGAGACCAGAAACAAACGGGTT
 
. : . : . : . : . : . :
JMFS140D06+ GAGAAGAAGTAGA
JMFS146E04+ GAGAAGAAGTAGACTTATTATAG
JMFS082D06+ GAGAAGAAGTAGACTTATTATAGATCA
JMFS018A07+ GAGAAGAAGTAGACTTATTATA
JMFS082D07+ GAGAAGAAGTAGACTTATTATAGATCA
JMFS122C08+ GAGAAGAAGTAGACTTATTATAGATCACGG
JMFS008A01+ GAGAAGAAGTAGACTTATTATAGATCACGG
JMFS063H06+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCA
JMFS090A10+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCACG
JMFS115F07+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCACGGGGAA
JMFS098H08+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCACGGGGAA
JMFS118E01+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCACGGGGAAGAA
JMFS146H02+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCACGGGGAAGAA
JMFS127B08+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCACGGGGAAGAA
JMFF043O03+ GAGAAGAAGTAGACTTATTATAGATCACGGATTCACGGGGAAGAAGAGTTTGGGTAAGCT
                      ____________________________________________________________
consensus GAGAAGAAGTAGACTTATTATAGATCACGGATTCACGGGGAAGAAGAGTTTGGGTAAGCT