Previous Contig 001867:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015H11Sequence559001867 (14)sp|P62302|RS13_SOYBN3e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFF043N13Sequence639001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13585001867 (14)sp|P62302|RS13_SOYBN7e-7840S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN014J04Sequence636001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN014L05Sequence627001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN019M17Sequence605001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN028C13Sequence513001867 (14)sp|P62302|RS13_SOYBN9e-7540S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN028O14Sequence604001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN028P15Sequence585001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN029A11Sequence593001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN030B13Sequence612001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMFN032B23Sequence621001867 (14)sp|P62302|RS13_SOYBN4e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13
JMSF043D19Sequence763001867 (14)sp|P62302|RS13_SOYBN6e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13714001867 (14)sp|P62302|RS13_SOYBN5e-7940S ribosomal protein S13.>gb:AY453393_1606937 Glycine max ribosomal protein S13

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043D19+ TTTTTTTTTTGGTGGGGAACTAGAGCATGCATTCAAATACCTTT
                      ____________________________________________________________
consensus TTTTTTTTTTGGTGGGGAACTAGAGCATGCATTCAAATACCTTT
 
. : . : . : . : . : . :
JMSF043D19+ CTAACAAACCAATCAAACACCATATACGAGTAACGAGAAATATGTAGCGCAGAACATTGA
                      ____________________________________________________________
consensus CTAACAAACCAATCAAACACCATATACGAGTAACGAGAAATATGTAGCGCAGAACATTGA
 
. : . : . : . : . : . :
JMFN014L05+ ACAGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
JMFN032B23+ ATTATGAATTGTCGAACAACATAATTGTATCAAATA
JMFN030B13+ AAACAGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
JMFN028O14+ CCCAAACAGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
rJMFF043N13- CCCAAACAGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
JMFN028P15+ AGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
JMFN014J04+ CCCAAACAGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
JMFN019M17+ TTGTATCAAATA
JMSF043D19+ GAAAAACAACATTCCCAAACAGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
JMFN029A11+ CGAACAACATAATTGTATCAAATA
JMFF043N13+ AGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
                      ____________________________________________________________
consensus GAAAAACAACATTCCCAAACAGCTATTATGAATTGTCGAACAACATAATTGTATCAAATA
 
. : . : . : . : . : . :
JMFN014L05+ ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN032B23+ ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN030B13+ ACAAAATTTGGTNTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN028O14+ ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
rJMFF043N13- ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN028P15+ ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN014J04+ ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN019M17+ AC-AAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMSF043D19+ ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN029A11+ ACAAAATTTGGTNTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFN028C13+ AAAGAAGAAAACTGATATGACACTCCATA
JMFF015H11+ TCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
JMFF043N13+ ACAAAATTTGGTNTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
                      ____________________________________________________________
consensus ACAAAATTTGGTTTAACAAACATTTCCCCATAAAGAAGAAAACTTCTATGACACTCCATA
 
. : . : . : . : . : . :
JMFN014L05+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN032B23+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN030B13+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN028O14+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
rJMFF043N13- ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN028P15+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN014J04+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN019M17+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMSF043D19+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN029A11+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFN028C13+ ATTAGAAAGATACTCCACTCTAGCCTAGCGTAAGCCTCAAGAGTGCTGGCAGTGGTGGAC
JMFF015H11+ ATTCGAAA-CTACTCCACTCTAGCCTAGCNTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
rJMSF043D19- CTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
JMFF043N13+ ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
                      ____________________________________________________________
consensus ATTCGAAA-CTACTCCACTCTAGCCTAGCCTAAGCCACAAGAGTGCTGGCAGTGGTGGAC
 
. : . : . : . : . : . :
JMFN014L05+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN032B23+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN030B13+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN028O14+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
rJMFF043N13- TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN028P15+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN014J04+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN019M17+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMSF043D19+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN029A11+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFN028C13+ TGGTATTTCCAGACAGGAGGGAGCTTATTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFF015H11+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
rJMSF043D19- TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
JMFF043N13+ TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
                      ____________________________________________________________
consensus TCGTATTTCCAGACAGGAGGGAGCTTCTTAGTCTTCTTGTAGTAGCGAGCAAGACGATGA
 
. : . : . : . : . : . :
JMFN014L05+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN032B23+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN030B13+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN028O14+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
rJMFF043N13- ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN028P15+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN014J04+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN019M17+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMSF043D19+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN029A11+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFN028C13+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTGTCC
JMFF015H11+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
rJMSF043D19- ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
JMFF043N13+ ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
                      ____________________________________________________________
consensus ATCCTACTCTCCACTAGAATCAAGCGGAACTTAGAGTCCTTGTCTTTTCTGTTCCTCTCC
 
. : . : . : . : . : . :
JMFN014L05+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN032B23+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN030B13+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN028O14+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
rJMFF043N13- AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN028P15+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN014J04+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN019M17+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMSF043D19+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN029A11+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFN028C13+ AAGTGCTTCATGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFF015H11+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
rJMSF043D19- AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
JMFF043N13+ AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
                      ____________________________________________________________
consensus AAGTGCTTCCTGATAGCAACAGCCTTCTTAATAAGGTGGTACAGATCCTCTGGAATCTCA
 
. : . : . : . : . : . :
JMFN014L05+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN032B23+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN030B13+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN028O14+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
rJMFF043N13- GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN028P15+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN014J04+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN019M17+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMSF043D19+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN029A11+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFN028C13+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFF015H11+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
rJMSF043D19- GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
JMFF043N13+ GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
                      ____________________________________________________________
consensus GGAGCAAGCCCATGAGCTTTTAGGATACGGAGAATCTTGCTTCCAGTGACACTCTTCACC
 
. : . : . : . : . : . :
JMFN014L05+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN032B23+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN030B13+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN028O14+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
rJMFF043N13- TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN028P15+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN014J04+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN019M17+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMSF043D19+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN029A11+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFN028C13+ TGAGCAATTCCGTGTGAATCCAGGAGAATAACTCCAATCTGAGAAGGAGTCATACCCCTC
JMFF015H11+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
rJMSF043D19- TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
JMFF043N13+ TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
                      ____________________________________________________________
consensus TGAGCAATTCCGTGTGAATCCCGGAGAATAACACCAATCTGAGAAGGAGTCATACCCCTC
 
. : . : . : . : . : . :
JMFN014L05+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN032B23+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN030B13+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN028O14+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
rJMFF043N13- TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN028P15+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN014J04+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN019M17+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMSF043D19+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN029A11+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFN028C13+ TTGGCGAACTTACAGATGTTCTCGTGGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFF015H11+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
rJMSF043D19- TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
JMFF043N13+ TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
                      ____________________________________________________________
consensus TTGGCGAACTTACAGATGTTCTCGTCGACATCTTGGGAAGAGATCTTGAGCCAGCTGGGA
 
. : . : . : . : . : . :
JMFN014L05+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFN032B23+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFN030B13+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFN028O14+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
rJMFF043N13- GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCG
JMFN028P15+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFN014J04+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFN019M17+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMSF043D19+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFN029A11+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFN028C13+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAAGACCCTTGCCGCGACTGTGCATGCGA
JMFF015H11+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
rJMSF043D19- GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
JMFF043N13+ GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
                      ____________________________________________________________
consensus GGGGTTCTCTTGTACGGAAGAGCTGAAGATGAAATACCCTTACCGCGACTGTGCATGCGA
 
. : . : . : . : . : . :
JMFN014L05+ CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGC
JMFN032B23+ CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGC
JMFN030B13+ CCCATGATGGCGGAGCTCTGCAAACTTCA
JMFN028O14+ CCCATGATGGCGGAGCTC
JMFN028P15+ CCCATG
JMFN014J04+ CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGCG
JMFN019M17+ CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGCGGAGACAAA
JMSF043D19+ CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGCGGAGACAAA
JMFN029A11+ CCCATGATGGCGGAGCTCTGCAAACTTCAG
JMFN028C13+ CCCA
JMFF015H11+ CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAAC
rJMSF043D19- CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGCGGAGACAAA
JMFF043N13+ CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGCGGAGACAAACCCTC
                      ____________________________________________________________
consensus CCCATGATGGCGGAGCTCTGCAAACTTCAGCTTCCACTGGAAACGCGGAGACAAACCCTC