Previous Contig 001863:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020L16Sequence507001863 (4)gb:AP003878_18347266e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11742009866 (3)gb:AP003878_18347252e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFF043M05Sequence613001863 (4)gb:AP003878_18347265e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11610009866 (3)gb:AP003878_18347255e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMSF040E21Sequence322001863 (4)283001863 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF020L16+ CTGAA
                      ____________________________________________________________
consensus CTGAA
 
. : . : . : . : . : . :
JMFF020L16+ ATGGCACCAAATGGTCTTTTAGCTCTGAGCTCCTCCAGTCTCTTCATACGCTTGACATCA
                      ____________________________________________________________
consensus ATGGCACCAAATGGTCTTTTAGCTCTGAGCTCCTCCAGTCTCTTCATACGCTTGACATCA
 
. : . : . : . : . : . :
JMFF020L16+ ATATCTACGTCAACCAGAGGCTTCTCTTCATCAGCTGAATCATCCTCTTCCTCATCAATT
JMFF043M05+ ATCATCCTCTTCCTCATCAATT
                      ____________________________________________________________
consensus ATATCTACGTCAACCAGAGGCTTCTCTTCATCAGCTGAATCATCCTCTTCCTCATCAATT
 
. : . : . : . : . : . :
JMFF020L16+ TTCACTGGTTTTTGCCAGACAGGATCCTCATCAACAATAATGACACCTGAGACATCAGTT
JMFF043M05+ TTCACTGGTTTTTGCCAGACAGGATCCTCATCAACAATAATGACACCTGAGACATCAGTT
                      ____________________________________________________________
consensus TTCACTGGTTTTTGCCAGACAGGATCCTCATCAACAATAATGACACCTGAGACATCAGTT
 
. : . : . : . : . : . :
JMFF020L16+ TTAGCTTTCTTTTTCTTCTTCTTCTTTTTCTTCTCCTCTTCATGGCCACTTTCATATTTT
JMSF040E21+ TCCTCTTCATGGCCACTTTCATA-TTT
JMFF043M05+ TTAGCTTTCTTTTTCTTCTTCTTCTTTTTCTTCTCCTCTTCATGGCCACTTTCATA-TTT
                      ____________________________________________________________
consensus TTAGCTTTCTTTTTCTTCTTCTTCTTTTTCTTCTCCTCTTCATGGCCACTTTCATA-TTT
 
. : . : . : . : . : . :
JMFF020L16+ TTTCAGATACTCCTTCAGTGATGTAGAGTCAGATGATGGAGCCACCATTCTGCCTCAATC
JMSF040E21+ TTTCAGATACTCCTTCAGTGATGTAGAGTCAGATGATGGAGCCACCATTCTGCCTCAATC
rJMSF040E21- GATACTCCTTCAGTGATGTAGAGTCAGATGATGGAGCCACCATTCTGCCTCAATC
JMFF043M05+ TTTCAGATACTCCTTCAGTGATGTAGAGTCAGATGATGGAGCCACCATTCTGCCTCAATC
                      ____________________________________________________________
consensus TTTCAGATACTCCTTCAGTGATGTAGAGTCAGATGATGGAGCCACCATTCTGCCTCAATC
 
. : . : . : . : . : . :
JMFF020L16+ AACAACTCCCTACACCAAAAATTATTCAACAGTGAACTGTCAACCGAGCTAGCAAGCTTC
JMSF040E21+ AACAACTCC--------------------CAGTGAACTGTCAACCGAGCTAGCAAGCTTC
rJMSF040E21- AACAACTCC--------------------CAGTGAACTGTCAACCGAGCTAGCAAGCTTC
JMFF043M05+ AACAACTCC--------------------CAGTGAACTGTCAACCGAGCTAGCAAGCTTC
                      ____________________________________________________________
consensus AACAACTCC--------------------CAGTGAACTGTCAACCGAGCTAGCAAGCTTC
 
. : . : . : . : . : . :
JMFF020L16+ TGCCTACCGCGTGCTGCCGAAAGAATCACGGAGAGACGGCGGGGGCCTGCTTGCCGACGG
JMSF040E21+ TGCCTACCGCGTGCTGCCGAAAGAATCACGGAGAGACGGCGGGGGCCTGCTTGCCGACGG
rJMSF040E21- TGCCTACCGCGTGCTGCCGAAAGAATCACGGAGAGACGGCGGGGGCCTGCTTGCCGACGG
JMFF043M05+ TGCCTACCGCGTGCTGCCGAAAGAATCACGGAGAGACGGCGGGGGCCTGCTTGCCGACGG
                      ____________________________________________________________
consensus TGCCTACCGCGTGCTGCCGAAAGAATCACGGAGAGACGGCGGGGGCCTGCTTGCCGACGG
 
. : . : . : . : . : . :
JMFF020L16+ CGGAGCTGCGGCCGGTTGTCGCTGCGGTCTGCGGAGGAGCTGCGGAAGTGCGGAGGAGTA
JMSF040E21+ CGGAGCTGCGGCCGGTTGTCGCTGCGGTCTGCGGAGGAGCTGCGGAAGTGCGGAGGAGTA
rJMSF040E21- CGGAGCTGCGGCCGGTTGTCGCTGCGGTCTGCGGAGGAGCTGCGGAAGTGCGGAGGAGTA
JMFF043M05+ CGGAGCTGCGGCCGGTTGTCGCTGCGGTCTGCGGAGGAGCTGCGGAAGTGCGGAGGAGTA
                      ____________________________________________________________
consensus CGGAGCTGCGGCCGGTTGTCGCTGCGGTCTGCGGAGGAGCTGCGGAAGTGCGGAGGAGTA
 
. : . : . : . : . : . :
JMFF020L16+ GAAGGCAGAAACCTATTTCCC
JMSF040E21+ GAAGGCAGAAACCTATTTCCCTATTTTGTTTAGTTTTCTTTCTTACTCCGT
rJMSF040E21- GAAGGCAGAAACCTATTTCCCTATTTTGTTTAGTTTTCTTTCTTACTCCGT
JMFF043M05+ GAAGGCAGAAACCTATTTCCCTATTTTGTTTAGTTTTCTTTCTTACTCCGTATGTATGTT
                      ____________________________________________________________
consensus GAAGGCAGAAACCTATTTCCCTATTTTGTTTAGTTTTCTTTCTTACTCCGTATGTATGTT