Previous Contig 001854:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043J12Sequence631001854 (2)gb:AB008269_15104793e-33Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSL3.576021686
JMFN028E07Sequence573001854 (2)pir|T50492|T504927e-34probable helix-loop-helix DNA binding protein - Arabidopsis thaliana>gb:ATT22D6_

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028E07+ TGACTATCATCA
                      ____________________________________________________________
consensus TGACTATCATCA
 
. : . : . : . : . : . :
JMFN028E07+ TTATCGGCTTCTGCTATCTCTTTAGACGACTTGTGGTTGGTGGGTGGCTCGAGGGGAACC
                      ____________________________________________________________
consensus TTATCGGCTTCTGCTATCTCTTTAGACGACTTGTGGTTGGTGGGTGGCTCGAGGGGAACC
 
. : . : . : . : . : . :
JMFN028E07+ CCTTCTTTGACACCATGAGATTCGGCGNCGNCGGTGGCGGCGGCGGCGGCGGAACAAAGC
                      ____________________________________________________________
consensus CCTTCTTTGACACCATGAGATTCGGCGNCGNCGGTGGCGGCGGCGGCGGCGGAACAAAGC
 
. : . : . : . : . : . :
JMFN028E07+ CATTGTTGAAGATTGGGGTTGAAGTTTCCGGTGGGAGGCAGCTGGAGAGGAGGCAGTTCG
JMFF043J12+ GGTGGGAGGCAGCTGGAGAGGAGGCAGTTCG
                      ____________________________________________________________
consensus CATTGTTGAAGATTGGGGTTGAAGTTTCCGGTGGGAGGCAGCTGGAGAGGAGGCAGTTCG
 
. : . : . : . : . : . :
JMFN028E07+ TCGATTTCATTCTTGGCAACGTTAAGCAACCAATCAACAACTTTACTGGGTTGATTTAGG
JMFF043J12+ TCGATTTCATTCTTGGCAACGTTAAGCAACCAATCAACAACTTTACTGGGTTGATTTAGG
                      ____________________________________________________________
consensus TCGATTTCATTCTTGGCAACGTTAAGCAACCAATCAACAACTTTACTGGGTTGATTTAGG
 
. : . : . : . : . : . :
JMFN028E07+ CCCAGCCGATCTTGGAGGTCGTATAATTGAATAGCAGTGGGCACCGAAAGCCTCACTCGC
JMFF043J12+ CCCAGCCGATCTTGGAGGTCGTATAATTGAATAGCAGTGGGCACCGAAAGCCTCACTCGC
                      ____________________________________________________________
consensus CCCAGCCGATCTTGGAGGTCGTATAATTGAATAGCAGTGGGCACCGAAAGCCTCACTCGC
 
. : . : . : . : . : . :
JMFN028E07+ CGGTCTCTTAATCCTCGGACGGTGCACACTTTGCTGTGCCGATCTTTCCCGCCGAATGCC
JMFF043J12+ CGGTCTCTTAATCCTCGGACGGTGCACACTTTGCTGTGCCGATCTTTCCCGCCGAATGCC
                      ____________________________________________________________
consensus CGGTCTCTTAATCCTCGGACGGTGCACACTTTGCTGTGCCGATCTTTCCCGCCGAATGCC
 
. : . : . : . : . : . :
JMFN028E07+ CGCGACACGCGAACAATCCTCGGATCCTTCAGCCTCGTCCACGCCGATGATGTCGGAGTA
JMFF043J12+ CGCGACACGCGAACAATCCTCGGATCCTTCAGCCTCGTCCACGCCGATGATGTCGGAGTA
                      ____________________________________________________________
consensus CGCGACACGCGAACAATCCTCGGATCCTTCAGCCTCGTCCACGCCGATGATGTCGGAGTA
 
. : . : . : . : . : . :
JMFN028E07+ GCAGCTATAGCAGCAGAAACCTTATTAAGATTCACATTTCTATGGTCGCTGCTTGTGTTC
JMFF043J12+ GCAGCTATAGCAGCAGAAACCTTATTAAGATTCACATTTCTATGGTCGCTGCTTGTGTTC
                      ____________________________________________________________
consensus GCAGCTATAGCAGCAGAAACCTTATTAAGATTCACATTTCTATGGTCGCTGCTTGTGTTC
 
. : . : . : . : . : . :
JMFN028E07+ CCCTCCTCCGGTTTTGTTGTCGCAGAAAAATCTACTTCTGTTGTAATCATCTTATGTCTC
JMFF043J12+ CCCTCCTCCGGTTTTGTTGTCGCAGAAAAATCTACTTCTGTTGTAATCATCTTATGTCTC
                      ____________________________________________________________
consensus CCCTCCTCCGGTTTTGTTGTCGCAGAAAAATCTACTTCTGTTGTAATCATCTTATGTCTC
 
. : . : . : . : . : . :
JMFN028E07+ TCATGCTTTCTTCCACATCAA
JMFF043J12+ TCATGCTTTCTTCCACATCAAATTATGATCTGATCTGATGGAGTAGCAGAAAAGTTGGCC
                      ____________________________________________________________
consensus TCATGCTTTCTTCCACATCAAATTATGATCTGATCTGATGGAGTAGCAGAAAAGTTGGCC
 
. : . : . : . : . : . :
JMFF043J12+ TGGGGGGTTTGGTCTCTAGTTACTTAGCCGCCCAAGCTAAGCTAAGGTAGATGAGATGAG
                      ____________________________________________________________
consensus TGGGGGGTTTGGTCTCTAGTTACTTAGCCGCCCAAGCTAAGCTAAGGTAGATGAGATGAG
 
. : . : . : . : . : . :
JMFF043J12+ ATGAGAGAGATGATAGGGTTTCCATTTCACACAATATAATGAATAATGAGGGAGGGCATA
                      ____________________________________________________________
consensus ATGAGAGAGATGATAGGGTTTCCATTTCACACAATATAATGAATAATGAGGGAGGGCATA
 
. : . : . : . : . : . :
JMFF043J12+ TAAAGTGAGGGAGATGAGATGAGAGGAGAATTAAAGATGCTGGAGTCCAAAATACAGTAC
                      ____________________________________________________________
consensus TAAAGTGAGGGAGATGAGATGAGAGGAGAATTAAAGATGCTGGAGTCCAAAATACAGTAC