Previous Contig 001850:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043I09Sequence644001850 (3)gb:AY085774_15708402e-44Arabidopsis thaliana clone 17996 mRNA, complete sequence.483010094 (3)gb:AY085774_15708402e-09Arabidopsis thaliana clone 17996 mRNA, complete sequence.
JMFF047A11Sequence164001850 (3)357010094 (3)gb:AY085774_15708401e-06Arabidopsis thaliana clone 17996 mRNA, complete sequence.
JMFN012E05Sequence642001850 (3)gb:AY085774_15708401e-53Arabidopsis thaliana clone 17996 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN012E05+ GCTCCATTAAGCGCGTTGAGAAACCAGTCCTCGGACT
                      ____________________________________________________________
consensus GCTCCATTAAGCGCGTTGAGAAACCAGTCCTCGGACT
 
. : . : . : . : . : . :
JMFN012E05+ TGGTTGAGCTCTCGAGAAGCGACCCGATTGACGACATCGTGTCGGACTTTGAAGGAAAGA
JMFF043I09+ AAGCGACCCGATTGACGACATCGTGTCGGACTTGNAAGGAAAGA
                      ____________________________________________________________
consensus TGGTTGAGCTCTCGAGAAGCGACCCGATTGACGACATCGTGTCGGACTTTGAAGGAAAGA
 
. : . : . : . : . : . :
JMFN012E05+ GGAATAATCGGAGCCGAGATGTCTTCGTACCGTTTGAATTAGAGTTGATGCGGTCGTACT
JMFF043I09+ GGAATAATCGGAGCCGAGATGTCTTCGTACCGTTTGAATTAGAGTTGATGCGGTCGTACT
                      ____________________________________________________________
consensus GGAATAATCGGAGCCGAGATGTCTTCGTACCGTTTGAATTAGAGTTGATGCGGTCGTACT
 
. : . : . : . : . : . :
JMFN012E05+ CATCGATCATGTTCTCCAGGTCTTCATCCGTGGTGACGGAGATTAAGGAGTCGAGGTCCT
JMFF043I09+ CATCGATCATGTTCTCCAGGTCTTCATCCGTGGTGACGGAGATTAAGGAGTCGAGGTCCT
                      ____________________________________________________________
consensus CATCGATCATGTTCTCCAGGTCTTCATCCGTGGTGACGGAGATTAAGGAGTCGAGGTCCT
 
. : . : . : . : . : . :
JMFN012E05+ CGTTGGGGAGCTGGTACTTGAGCGAGAAGGAGCGGCCATTCAGGAGCGTTTTGGAGAGGC
JMFF043I09+ CGTTGGGGAGCTGGTACTTGAGCGAGAAGGAGCGGCCATTCAGGAGCGTTTTGGAGAGGC
                      ____________________________________________________________
consensus CGTTGGGGAGCTGGTACTTGAGCGAGAAGGAGCGGCCATTCAGGAGCGTTTTGGAGAGGC
 
. : . : . : . : . : . :
JMFN012E05+ GGAGGGAGAGGTCGGAGAGCGATGAGTGCCGATCGGTGACGATGATTCGCGTGTCGCCGC
JMFF043I09+ GGAGGGAGAGGTCGGAGAGCGATGAGTGCCGATCGGTGACGATGATTCGCGTGTCGCCGC
                      ____________________________________________________________
consensus GGAGGGAGAGGTCGGAGAGCGATGAGTGCCGATCGGTGACGATGATTCGCGTGTCGCCGC
 
. : . : . : . : . : . :
JMFN012E05+ CGACGTAGCAGAGCGACTTATCGTGCGGGCGGGGAACGATGTGGCCGCCGTAGCTGCACA
JMFF043I09+ CGACGTAGCAGAGCGACTTATCGTGCGGGCGGGGAACGATGTGGCCGCCGTAGCTGCACA
                      ____________________________________________________________
consensus CGACGTAGCAGAGCGACTTATCGTGCGGGCGGGGAACGATGTGGCCGCCGTAGCTGCACA
 
. : . : . : . : . : . :
JMFN012E05+ TCAGCCGCAGCTTTCCGCCGCCTGGAGCTGCGGCGGCGTACGGAGGAGGCTCATCCCAGT
JMFF047A11+ GT
JMFF043I09+ TCAGCCGCAGCTTTCCGCCGCCTGGAGCTGCGGCGGCGTACGGAGGAGGCTCATCCCAGT
                      ____________________________________________________________
consensus TCAGCCGCAGCTTTCCGCCGCCTGGAGCTGCGGCGGCGTACGGAGGAGGCTCATCCCAGT
 
. : . : . : . : . : . :
JMFN012E05+ CAGTGTTGCGTGACCGCGGCGAGGAGTCAATCGAGTCAGCGTAGTTGACATGCGTTGGTG
JMFF047A11+ CAGTGTTGCGTGACCGCGGCGAGGAGTCAATCGAGTCAGCGTAGTTGACATGCGTCGTTG
JMFF043I09+ CAGTGTTGCGTGACCGCGGCGAGGAGTCAATCGAGTCAGCGTAGTTGACATGCGTTGGTG
                      ____________________________________________________________
consensus CAGTGTTGCGTGACCGCGGCGAGGAGTCAATCGAGTCAGCGTAGTTGACATGCGTTGGTG
 
. : . : . : . : . : . :
JMFN012E05+ GCGGCGGCGGAATCTGCGGCTGTTGTTGCCCCACCGCCGCGACCGCCGCCGCGGCGGATG
JMFF047A11+ GCGCCCNNNNNNTNTNCGNCTGTTGTTGCCCCACCGCCGCGACCGCCGCCGCGGCGGATG
JMFF043I09+ GCGGCGGCGGAATCTGCGGCTGTTGTTGCCCCACCGCCGCGACCGCCGCCGCGGCGGATG
                      ____________________________________________________________
consensus GCGGCGGCGGAATCTGCGGCTGTTGTTGCCCCACCGCCGCGACCGCCGCCGCGGCGGATG
 
. : . : . : . : . : . :
JMFN012E05+ AATTAGGTCCGCTTGAGAGAGGCGGAGTATCCATAGACGGCCGCAGAGGATTTGGGCGAA
JMFF047A11+ AATTAGGTCCGCTTGAGAGAGGCGGAGTATCCATAGACGGCC
JMFF043I09+ AATTAGGTCCGCTTGAGAGAGGCGGAGTATCCATAGACGGCCGCAGAGGATTTGGGCGAA
                      ____________________________________________________________
consensus AATTAGGTCCGCTTGAGAGAGGCGGAGTATCCATAGACGGCCGCAGAGGATTTGGGCGAA
 
. : . : . : . : . : . :
JMFN012E05+ ATTTG
JMFF043I09+ ATTTGTTAAAAGGGGGGTAAGAGGTTTCGCCAGGCAGGATTTCTCATGTACTCGATAATC
                      ____________________________________________________________
consensus ATTTGTTAAAAGGGGGGTAAGAGGTTTCGCCAGGCAGGATTTCTCATGTACTCGATAATC