Previous Contig 001849:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026O09Sequence556001849 (7)sp|P21343|PFPB_SOLTU2e-49Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.829009480 (9)pir|B36094|B36094e-114diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMFF027A19Sequence476001849 (7)sp|P21343|PFPB_SOLTU4e-51Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.756009480 (9)pir|B36094|B36094e-101diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMFF043I01Sequence654001849 (7)sp|P21343|PFPB_SOLTU1e-68Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.463009480 (9)pir|T01470|T014702e-45diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF005L08Sequence366001849 (7)sp|P21343|PFPB_SOLTU7e-29Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.101009480 (9)
JMSF011A02Sequence272001849 (7)gb:AF095520_17677651e-14Citrus X paradisi pyrophosphate-dependent phosphofructokinase beta subunit (PPi-776009480 (9)pir|B36094|B36094e-106diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF025B13Sequence661001849 (7)sp|P21343|PFPB_SOLTU2e-86Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.737009480 (9)pir|B36094|B36094e-105diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF030L23Sequence661001849 (7)sp|P21343|PFPB_SOLTU8e-87Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.762009480 (9)sp|P21343|PFPB_SOLTU2e-97Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030L23+ TACAAGCCCATCCAAATCAAGC
JMSF025B13+ TCANTACAAGCCCATCCAAATCAAGC
                      ____________________________________________________________
consensus TCANTACAAGCCCATCCAAATCAAGC
 
. : . : . : . : . : . :
JMSF030L23+ TTTTTTGCTGTTTCTTCAGCTTGCTTAAACTGATCTGGAGTCTCAATCTTGTCCCTCCCA
JMSF025B13+ TTTTTTGCTGTTTCTTCAGCTTGCTTAAACTGATCTGGAGTCTCAATCTTGTCCCTCCCA
                      ____________________________________________________________
consensus TTTTTTGCTGTTTCTTCAGCTTGCTTAAACTGATCTGGAGTCTCAATCTTGTCCCTCCCA
 
. : . : . : . : . : . :
JMSF030L23+ CTGCAAATCATATCAAAGCCACCCTGATTTCTGTATGGGTAGATATATTCTGGTGTGAGT
JMSF025B13+ CTGCAAATCATATCAAAGCCACCCTGATTTCTGTATGGGTAGATATATTCTGGTGTGAGT
JMFF043I01+ AATCATATCAAAGCCACCCTGATTTCTGTATGGGTAGATATATTCTGGTGTGAGT
                      ____________________________________________________________
consensus CTGCAAATCATATCAAAGCCACCCTGATTTCTGTATGGGTAGATATATTCTGGTGTGAGT
 
. : . : . : . : . : . :
JMSF030L23+ ATCACATACTTGCACTTCATGATCCCAGCTGGTCCACCCCTGAACCCATACAATGTGCTT
JMSF025B13+ ATCACATACTTGCACTTCATGATCCCAGCTGGTCCACCCCTGAACCCATACAATGTGCTT
JMFF026O09+ AACCCATACAATGTGCTT
JMFF027A19+ TGAACCCATACAATGTGCTT
JMFF043I01+ ATCACATACTTGCACTTCATGATCCCAGCTGGTCCACCCCTGAACCCATACAATGTGCTT
                      ____________________________________________________________
consensus ATCACATACTTGCACTTCATGATCCCAGCTGGTCCACCCCTGAACCCATACAATGTGCTT
 
. : . : . : . : . : . :
JMSF030L23+ CCTTTGCAATGCTCCTGCAAATAATCGAAAATTCCGGAAATAACATTATGCCCTCCAGGT
JMSF025B13+ CCTTTGCAATGCTCCTGCAAATAATCGAAAATTCCGGAAATAACATTATGCCCTCCAGGT
JMFF026O09+ CCTTTGCAATGCTCCTGCAAATAATCGAAAATTCCGGAAATAACATTATGCCCTCCAGGT
JMFF027A19+ CCTTTGCAATGCTCCTGCAAATAATCGAAAATTCCGGAAATAACATTATGCCCTCCAGGT
JMFF043I01+ CCTTTGCAATGCTCCTGCAAATAATCGAAAATTCCGGAAATAACATTATGCCCTCCAGGT
                      ____________________________________________________________
consensus CCTTTGCAATGCTCCTGCAAATAATCGAAAATTCCGGAAATAACATTATGCCCTCCAGGT
 
. : . : . : . : . : . :
JMSF030L23+ GCTTGGCCACCAGACAAAACCACTCCAATCTTCAAATTATGGTTCATTGCAACATCACCC
JMSF025B13+ GCTTGGCCACCAGACAAAACCACTCCAATCTTCAAATTATGGTTCATTGCAACATCACCC
JMFF026O09+ GCTTGGCCACCAGACAAAACCACTCCAATCTTCAAATTATGGTTCATTGCAACATCACCC
JMFF027A19+ GCTTGGCCACCAGACAAAACCACTCCAATCTTCAAATTATGGTTCATTGCAACATCACCC
JMSF005L08+ TCAAATTATGGTTCATTGCAACATCACCC
JMFF043I01+ GCTTGGCCACCAGACAAAACCACTCCAATCTTCAAATTATGGTTCATTGCAACATCACCC
                      ____________________________________________________________
consensus GCTTGGCCACCAGACAAAACCACTCCAATCTTCAAATTATGGTTCATTGCAACATCACCC
 
. : . : . : . : . : . :
JMSF030L23+ GAATCATCTGGCACCAATGCTGCTGATGGTTGACCAAATAAGCCAGGAAACAACTTTGCA
JMSF025B13+ GAATCATCTGGCACCAATGCTGCTGATGGTTGACCAAATAAGCCAGGAAACAACTTTGCA
JMFF026O09+ GAATCATCTGGCACCAATGCTGCTGATGGTTGACCAAATAAGCCAGGAAACAACTTTGCA
JMFF027A19+ GAATCATCTGGCACCAATGCTGCTGATGGTTGACCAAATAAGCCAGGAAACAACTTTGCA
JMSF005L08+ GAATCATCTGGCACCAATGCTGCTGATGGTTGACCAAATAAGCCAGGAAACAACTTTGCA
JMFF043I01+ GAATCATCTGGCACCAATGCTGCTGATGGTTGACCAAATAAGCCAGGAAACAACTTTGCA
                      ____________________________________________________________
consensus GAATCATCTGGCACCAATGCTGCTGATGGTTGACCAAATAAGCCAGGAAACAACTTTGCA
 
. : . : . : . : . : . :
JMSF030L23+ ATCTCCTCTGGATGGCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
JMSF025B13+ ATCTCCTCTGGATGGCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
JMFF026O09+ ATCTCCTCTGGATGGCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
JMFF027A19+ ATCTCCTCTGGATGGCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
JMSF011A02+ CTCTGGATGNCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
JMSF005L08+ ATCTCCTCTGGATGGCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
JMFF043I01+ ATCTCCTCTGGATGGCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
                      ____________________________________________________________
consensus ATCTCCTCTGGATGGCCGGCCGCAGAGCTGGCGGGGCCGTCGACGACTTTGAAGGACTTA
 
. : . : . : . : . : . :
JMSF030L23+ CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTGTTCTGTACTTCACTGTAA
JMSF025B13+ CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTGTTCTGTACTTCACTGTAA
JMFF026O09+ CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTCTTCTGTACTTCACTGTAA
JMFF027A19+ CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTGTTCTGTACTTCACTGTAA
JMSF011A02+ CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTGTTCTGTACTTCACTGTAA
JMSF005L08+ CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTGTTCTGTACTTCACTGTAA
JMFF043I01+ CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTCTTCTGTACTTCACTGTAA
                      ____________________________________________________________
consensus CGGAGGACAGATGGGAGAGGGAGCGGGTGATCGAGACGGCTGTTCTGTACTTCACTGTAA
 
. : . : . : . : . : . :
JMSF030L23+ ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
JMSF025B13+ ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
JMFF026O09+ ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
JMFF027A19+ ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
JMSF011A02+ ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
JMSF005L08+ ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
JMFF043I01+ ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
                      ____________________________________________________________
consensus ACGGAGGCGTAACGTCCGGTGGAAGTTTTCGCGGACGCAATGTCGGAGTTAGCCAACAGG
 
. : . : . : . : . : . :
JMSF030L23+ GAAATCGCCGGCGCCATTGATTGATTTTCACCT-AACGGAGAGAGAGAGTGAGGAAGATA
JMSF025B13+ GAAATCGCCGGCGCCATTGATTGATTTTCACCT-AACGGAAAGAGAGAGTGAGGAAGATA
JMFF026O09+ GAAATCGCCGGCGCCATTGATTGATTTTCACCT-AACGGAGAGAGAGAGTGAGGAAGATA
JMFF027A19+ GAAATCGCCGGCGCCATTGATTGATTTTCACCTAAACGGAGAGAGAGAGTGAGGAAGATA
JMSF011A02+ GAAATCGCCGGCGCCATTGATTGATTTTCACCT-AACGGAGAGAGAGAGTGAGGAAGATA
JMSF005L08+ GAAATCGCCGGCGCCATTGATTGATTTTCACCT-AACGGAGAGAGAGAGTGAGGAAGATA
JMFF043I01+ GAAATCGCCGGCGCCATTGATTGATTTTCACCT-AACGGAGAGAGAGAGTGAGGAAGATA
                      ____________________________________________________________
consensus GAAATCGCCGGCGCCATTGATTGATTTTCACCT-AACGGAGAGAGAGAGTGAGGAAGATA
 
. : . : . : . : . : . :
JMSF030L23+ CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTC
JMSF025B13+ CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTC
JMFF026O09+ CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTCGGAGTGGCTTTCTGTGCGCTGCACT
JMFF027A19+ CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTC
JMSF011A02+ CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTCG
JMSF005L08+ CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTCG
JMFF043I01+ CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTCGGAGTGGCTTTCTGTGCGCTGCACT
                      ____________________________________________________________
consensus CGAGAAGAAGAGCTCACTACTGAAGTAGATCTTTCGGAGTGGCTTTCTGTGCGCTGCACT
 
. : . : . : . : . : . :
JMFF026O09+ GTCATTTTAAGGCCCAGTAACGTGTCGAGGGCAAAATCGTCCTCTGGAAACTCCGCCCC
JMFF043I01+ GTCATTTTAAGGCCCAGTAACGTGTCGAGGGCAAAATCGTCCTCTGGAAACTCCGCCCCC
                      ____________________________________________________________
consensus GTCATTTTAAGGCCCAGTAACGTGTCGAGGGCAAAATCGTCCTCTGGAAACTCCGCCCCC