Previous Contig 001845:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043F22Sequence590001845 (2)gb:AP004125_18379622e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ17600011017 (2)gb:CAR276419_16452134e-18Cicer arietinum mRNA for 25.7 kDa protein.
JMFF050L11Sequence635001845 (2)gb:BT005472_16384127e-72Arabidopsis thaliana clone U50958 unknown protein (At1g44835) mRNA, complete cds622011017 (2)gb:CAR276419_16452134e-18Cicer arietinum mRNA for 25.7 kDa protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050L11+ TTTTCAGNGTACATCTGGTAGGACTATGCATCNAGATGGAAC
                      ____________________________________________________________
consensus TTTTCAGNGTACATCTGGTAGGACTATGCATCNAGATGGAAC
 
. : . : . : . : . : . :
JMFF050L11+ AAGGGCAGCTAGATCAGGAGGTTGATCCTTTCCAATTGGAGGATTAGCCTCCAGATCAAC
JMFF043F22+ CCTTTCCAATTGGAGGATTAGCCTCCAGATCAAC
                      ____________________________________________________________
consensus AAGGGCAGCTAGATCAGGAGGTTGATCCTTTCCAATTGGAGGATTAGCCTCCAGATCAAC
 
. : . : . : . : . : . :
JMFF050L11+ ATAGGCGGGAGTTTTTCCAATTGAATTTAAAAACTTGTCAAGGTCACGGGCATTAAGAGC
JMFF043F22+ ATAGGCGGGAGTTTTTCCAATTGAATTTAAAAACTTGTCAAGGTCACGGGCATTAAGAGC
                      ____________________________________________________________
consensus ATAGGCGGGAGTTTTTCCAATTGAATTTAAAAACTTGTCAAGGTCACGGGCATTAAGAGC
 
. : . : . : . : . : . :
JMFF050L11+ AATTGATGTATCATTTGAGAGTGGATGGAAGATGCAACGTTCTTGAGTCTTAAGCCCTTG
JMFF043F22+ AATTGATGTATCATTTGAGAGTGGATGGAAGATGCAACGTTCTTGAGTCTTAAGCCCTTG
                      ____________________________________________________________
consensus AATTGATGTATCATTTGAGAGTGGATGGAAGATGCAACGTTCTTGAGTCTTAAGCCCTTG
 
. : . : . : . : . : . :
JMFF050L11+ ATCTAACACCAAAGAAACATGCCTTGCTGATTCATTTACAAGTGCAAAAGGAGTAACAGA
JMFF043F22+ ATCTAACACCAAAGAAACATGCCTTGCTGATTCATTTACAAGTGCAAAAGGAGTAACAGA
                      ____________________________________________________________
consensus ATCTAACACCAAAGAAACATGCCTTGCTGATTCATTTACAAGTGCAAAAGGAGTAACAGA
 
. : . : . : . : . : . :
JMFF050L11+ ACCAAGTGGCACCTGAAGGACTTCTGTAAAGGCTTCTTCAGGTGCCATTCTTAGACCTCC
JMFF043F22+ ACCAAGTGGCACCTGAAGGACTTCTGTAAAGGCTTCTTCAGGTGCCATTCTTAGACCTCC
                      ____________________________________________________________
consensus ACCAAGTGGCACCTGAAGGACTTCTGTAAAGGCTTCTTCAGGTGCCATTCTTAGACCTCC
 
. : . : . : . : . : . :
JMFF050L11+ CTTCCCCAAACCAAGCCTCTGAGACAAAACTTTCAGATCTACTTTGGTCTCTGACAGAGC
JMFF043F22+ CTTCCCCAAACCAAGCCTTTGAGACAAAACTTTCAGATCTACTTTGGTCTCTGACAGAGC
                      ____________________________________________________________
consensus CTTCCCCAAACCAAGCCTTTGAGACAAAACTTTCAGATCTACTTTGGTCTCTGACAGAGC
 
. : . : . : . : . : . :
JMFF050L11+ AGAAACAATATAAAATCTATTTTTCTTGTCCTTCAAGAATAGGTTCTTGCACAGTGCACC
JMFF043F22+ AGAAACAATATAAAATCTATTTTTCTTGTCCTTCAAGAATAGGTTCTTGCACAGTGCACC
                      ____________________________________________________________
consensus AGAAACAATATAAAATCTATTTTTCTTGTCCTTCAAGAATAGGTTCTTGCACAGTGCACC
 
. : . : . : . : . : . :
JMFF050L11+ TTTTATATTCCCAACATATTTTGCCTGAGCTTCAACTGTCATAACAACAGGGTGGTCACA
JMFF043F22+ TTTTATATTCCCAACATATTTTGCCTGAGCTTCAACTGTCATAACAACAGGGTGGTCACA
                      ____________________________________________________________
consensus TTTTATATTCCCAACATATTTTGCCTGAGCTTCAACTGTCATAACAACAGGGTGGTCACA
 
. : . : . : . : . : . :
JMFF050L11+ CCTGGCGAAATCAATTTGCAGCTCCTGCAAACGAGCGAGCAATTGCTCCTTGGAATGGGC
JMFF043F22+ CCTGGCGAAATCAATTTGCAGCTCCTGCAAACGAGCGAGCAATTGCTCCTTGGAATGGGC
                      ____________________________________________________________
consensus CCTGGCGAAATCAATTTGCAGCTCCTGCAAACGAGCGAGCAATTGCTCCTTGGAATGGGC
 
. : . : . : . : . : . :
JMFF050L11+ CATTCTATCTCCTTCGTCCTTCAAAGTTTTTCTCGGAATCACAGGGAGCTATT
JMFF043F22+ CATTCTATCTCCTTCGTCCTTCAAAGTTTTTCTCGGAATCACAGGGAGCTATTGACGTCC
                      ____________________________________________________________
consensus CATTCTATCTCCTTCGTCCTTCAAAGTTTTTCTCGGAATCACAGGGAGCTATTGACGTCC