Previous Contig 001843:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043E06Sequence641001843 (2)gb:AP000375_18198222e-12Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.580021675gb:AP000375_18198228e-12Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.
JMSF011C04Sequence323001843 (2)sp|P57741|PFD3_ARATH7e-28Probable prefoldin subunit 3.>gb:AB023033_1515341 Arabidopsis thaliana genomic D154022414

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043E06+ TATAAATCCTTGAGAAACATTTCATCTCATCTGGACTGCCT
                      ____________________________________________________________
consensus TATAAATCCTTGAGAAACATTTCATCTCATCTGGACTGCCT
 
. : . : . : . : . : . :
JMFF043E06+ GGTGTTGTCTGATCTCCATAACTGAACTCCTCGGGCATTTTAATCTCGAGTTCATCAGAT
                      ____________________________________________________________
consensus GGTGTTGTCTGATCTCCATAACTGAACTCCTCGGGCATTTTAATCTCGAGTTCATCAGAT
 
. : . : . : . : . : . :
JMFF043E06+ AGCTGATCAATGGATGTATTAGCATCCACATCAAAGATTCCCTCAGCCCTGAGAACAATG
                      ____________________________________________________________
consensus AGCTGATCAATGGATGTATTAGCATCCACATCAAAGATTCCCTCAGCCCTGAGAACAATG
 
. : . : . : . : . : . :
JMFF043E06+ TAGCCAGTTTTCTTCTGCATCTCTTCGGATTCATTGCTCCCCTTCATGCTCTTCTCAAGG
                      ____________________________________________________________
consensus TAGCCAGTTTTCTTCTGCATCTCTTCGGATTCATTGCTCCCCTTCATGCTCTTCTCAAGG
 
. : . : . : . : . : . :
JMSF011C04+ CACGAACGCCGCCGC
JMFF043E06+ TCCTCAATCCTCTTCTCCATGAACTCAATATCCTGAACAGTTCTTCACGAACACCGCCGC
                      ____________________________________________________________
consensus TCCTCAATCCTCTTCTCCATGAACTCAATATCCTGAACAGTTCTTCACGAACGCCGCCGC
 
. : . : . : . : . : . :
JMSF011C04+ CGGAATTCCTCTCCTCTCCGTCAATCCGGAGGTTGATGAAGAAGTCGCAACCTCCGCCGC
JMFF043E06+ CGAAATTCCTCTCCTCTCCGTTAATCCGGAGGTTGATGATGAAGCCGCAACCAACGCCAC
                      ____________________________________________________________
consensus CGGAATTCCTCTCCTCTCCGTTAATCCGGAGGTTGATGATGAAGTCGCAACCTCCGCCGC
 
. : . : . : . : . : . :
JMSF011C04+ CATCTGCAA
JMFF043E06+ CATCTGCAAGTGGTCTTGTGCTCTGAGCTTTCTTCTTCTTTCTTCTTCGATGGAGCGGCG
                      ____________________________________________________________
consensus CATCTGCAAGTGGTCTTGTGCTCTGAGCTTTCTTCTTCTTTCTTCTTCGATGGAGCGGCG
 
. : . : . : . : . : . :
JMFF043E06+ GTCGTGGGTGTCTGAAGCAGGGGCGGAGACGTCGGCTATGGCGGTGGTAGCAGTGGTGGC
                      ____________________________________________________________
consensus GTCGTGGGTGTCTGAAGCAGGGGCGGAGACGTCGGCTATGGCGGTGGTAGCAGTGGTGGC
 
. : . : . : . : . : . :
JMFF043E06+ GTCGGCAGATCAGCGCTGGAGGCGGTGGCTGCGTCGAGGTTGTCACGGTGTGGTGCGCAT
                      ____________________________________________________________
consensus GTCGGCAGATCAGCGCTGGAGGCGGTGGCTGCGTCGAGGTTGTCACGGTGTGGTGCGCAT
 
. : . : . : . : . : . :
JMFF043E06+ CAGCAGATCGTCGTCACGGTGGAGGTTGTGAGGCCAACGGCGTGGTGGCGGTAGGTGTTG
                      ____________________________________________________________
consensus CAGCAGATCGTCGTCACGGTGGAGGTTGTGAGGCCAACGGCGTGGTGGCGGTAGGTGTTG
 
. : . : . : . : . : . :
JMFF043E06+ TGGCGATGAGACGATCGAAGCAGATGGCGGATGAAGATTTTAGATCTGAGATGCGAATTT
                      ____________________________________________________________
consensus TGGCGATGAGACGATCGAAGCAGATGGCGGATGAAGATTTTAGATCTGAGATGCGAATTT