Previous Contig 001833:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043B10Sequence651001833 (32)gb:AE005674_700708e-31Shigella flexneri 2a str. 301, complete genome.>gb:AE016979_370459 Shigella flex628021666sp|P38054|CUSA_ECOLIe-106Cation efflux system protein cusA.>pir|E64790|E64790 ybdE protein - Escherichia
JMSF001G13Sequence365001833 (32)gb:AE005674_700701e-16Shigella flexneri 2a str. 301, complete genome.>gb:AE016979_370459 Shigella flex
JMSF003G10Sequence410001833 (32)gb:AE016979_3704583e-20Shigella flexneri 2a str. 2457T section 2 of 16 of the complete genome.>gb:AE014
JMSF006K13Sequence408001833 (32)gb:AE016979_3704581e-19Shigella flexneri 2a str. 2457T section 2 of 16 of the complete genome.>gb:AE014338011347 (6)
JMSF008L16Sequence330001833 (32)gb:AE005674_700701e-16Shigella flexneri 2a str. 301, complete genome.>gb:AE016979_370459 Shigella flex
JMSF010I18Sequence348001833 (32)gb:AE005674_700701e-16Shigella flexneri 2a str. 301, complete genome.>gb:AE016979_370459 Shigella flex
JMSF012I02Sequence431001833 (32)gb:AE016979_3704585e-22Shigella flexneri 2a str. 2457T section 2 of 16 of the complete genome.>gb:AE014
JMSF015M13Sequence160001833 (32)gb:AE005674_700701e-16Shigella flexneri 2a str. 301, complete genome.>gb:AE016979_370459 Shigella flex
JMSF017A18Sequence161001833 (32)gb:AE005674_700701e-16Shigella flexneri 2a str. 301, complete genome.>gb:AE016979_370459 Shigella flex
JMSF019O21Sequence268001833 (32)gb:AE005674_700701e-16Shigella flexneri 2a str. 301, complete genome.>gb:AE016979_370459 Shigella flex
JMSF021N09Sequence603001833 (32)gb:D90700_1212736e-35Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF023A22Sequence438001833 (32)gb:AE016979_3704589e-26Shigella flexneri 2a str. 2457T section 2 of 16 of the complete genome.>gb:AE014650012234 (3)gb:BT020398_16427938e-42Arabidopsis thaliana At1g28280 mRNA, complete cds.>gb:BT020477_1642871 Arabidops
JMSF023O20Sequence613001833 (32)gb:D90700_1212732e-37Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF026I01Sequence605001833 (32)gb:D90700_1212731e-35Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF026J13Sequence618001833 (32)gb:D90700_1212733e-36Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).630005693 (27)sp|P10933|FENR_PEA9e-87Ferredoxin--NADP reductase, leaf isozyme, chloroplast precursor (EC 1.18.1.2) (F
JMSF026P10Sequence600001833 (32)gb:D90700_1212732e-34Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF032E18Sequence640001833 (32)gb:D90700_1212731e-41Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF032M09Sequence638001833 (32)gb:D90700_1212731e-41Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF033M24Sequence607001833 (32)gb:D90700_1212731e-35Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF033N05Sequence608001833 (32)gb:D90700_1212732e-33Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF035A17Sequence639001833 (32)gb:D90700_1212731e-41Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF035M20Sequence594001833 (32)gb:D90700_1212734e-33Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF036F16Sequence410001833 (32)gb:AE016979_3704586e-20Shigella flexneri 2a str. 2457T section 2 of 16 of the complete genome.>gb:AE014658008551 (67)gb:AY066012_15665851e-92Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF038I08Sequence637001833 (32)gb:D90700_1212734e-41Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF040O11Sequence584001833 (32)gb:D90700_1212735e-30Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF041A11Sequence491001833 (32)gb:AE016979_3704581e-26Shigella flexneri 2a str. 2457T section 2 of 16 of the complete genome.>gb:AE014589013198 (5)gb:AP004800_18452861e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P058
JMSF041A15Sequence680001833 (32)gb:D90700_1212734e-50Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF042M21Sequence720001833 (32)gb:D90700_1212732e-57Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).470004735 (45)sp|P49132|CPTR_FLATR4e-31Triose phosphate/phosphate translocator, chloroplast precursor (CTPT).>pir|S3755
JMSF046H16Sequence704001833 (32)gb:D90700_1212733e-52Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF049M10Sequence604001833 (32)gb:D90700_1212731e-35Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF050M16Sequence638001833 (32)gb:D90700_1212731e-41Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).
JMSF052P10Sequence600001833 (32)gb:D90700_1212736e-35Escherichia coli K12 genomic DNA. (12.8 - 13.2 min).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046H16+ TTG
JMSF042M21+ TTAATGCTTGGGTATATTTG
                      ____________________________________________________________
consensus TTAATGCTTGGGTATATTTG
 
. : . : . : . : . : . :
JMSF046H16+ CTGATTTAAACAGGGATTTTTGTGGATCGGACTTCAGATTGATAAAGGGGACGCCGCGTA
JMSF042M21+ CTGATTT-AACAGGGATTTTTGTGGATCGGACTTCAGATTGATAAAGGGGACGCCGCGTA
JMSF041A15+ TGGATCGGACTTCAGATTGATAAAGGGGACGCCGCGTA
                      ____________________________________________________________
consensus CTGATTTAAACAGGGATTTTTGTGGATCGGACTTCAGATTGATAAAGGGGACGCCGCGTA
 
. : . : . : . : . : . :
JMSF046H16+ GCTCCGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF042M21+ GCTCCGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF041A15+ GCTCCGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF035A17+ CCGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF050M16+ CGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF032M09+ CGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF038I08+ CGACGACAGCATAAAAATCTTGCCGCCNATTTTAAAAACATCGAACTCCGGGCCAA
JMSF023O20+ CGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF032E18+ TCCGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
JMSF033M24+ TTAAAAACATCGAACTCCGGGCCAA
JMSF026I01+ TTAAAAACATCGAACTCCGGGCCAA
JMSF049M10+ AAAAACATCGAACTCCGGGCCAA
JMSF026J13+ TTTAAAAACATCGAACTCCGGGCCAA
JMSF026P10+ ACATCGAACTCCGGGCCAA
JMSF035M20+ ACTCCGGGCCAA
JMSF033N05+ TCCGGGCCAA
JMSF052P10+ AAACATCGAACTCCGGGCCAA
JMSF040O11+ CCAA
JMSF021N09+ AAACATCGAACTCCGGGCCAA
                      ____________________________________________________________
consensus GCTCCGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAAACATCGAACTCCGGGCCAA
 
. : . : . : . : . : . :
JMSF046H16+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF042M21+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF041A15+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF035A17+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF050M16+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF032M09+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF038I08+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF023O20+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF032E18+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF033M24+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF026I01+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF049M10+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF026J13+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF026P10+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF035M20+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF033N05+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF052P10+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF040O11+ AAGNCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMSF021N09+ AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
JMFF043B10+ GCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
                      ____________________________________________________________
consensus AAGGCCAGCAAAGCTCGACAAAGGGTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCA
 
. : . : . : . : . : . :
JMSF046H16+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF042M21+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF041A15+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF035A17+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF050M16+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF032M09+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF038I08+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF023O20+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF032E18+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF033M24+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF026I01+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF049M10+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF026J13+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF026P10+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF035M20+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF033N05+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF052P10+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF040O11+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF021N09+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF041A11+ TTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
JMSF023A22+ GAAGGAGAATAAGCAAAGTATGCCGCGA
JMFF043B10+ GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
                      ____________________________________________________________
consensus GTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGA
 
. : . : . : . : . : . :
JMSF046H16+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF042M21+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF041A15+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF035A17+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF050M16+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF032M09+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF038I08+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF023O20+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF032E18+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF033M24+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF026I01+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF049M10+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF026J13+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF026P10+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF035M20+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF033N05+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF052P10+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF040O11+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF021N09+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF041A11+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMSF023A22+ AGTACGGCGATAATCGACGTTTAATNCGCCAGCGAGANCCAGCGTCG-CCAGATAAAGCG
JMSF012I02+ CGAGAACCAGCGTCGCCCAGATAAAGCG
JMSF003G10+ ATAAAGCG
JMSF006K13+ AAGCG
JMSF036F16+ CCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
JMFF043B10+ AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
                      ____________________________________________________________
consensus AGTACGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCG-CCAGATAAAGCG
 
. : . : . : . : . : . :
JMSF046H16+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF042M21+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF041A15+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF035A17+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF050M16+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF032M09+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF038I08+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF023O20+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF032E18+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF033M24+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF026I01+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF049M10+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF026J13+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF026P10+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF035M20+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF033N05+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF052P10+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF040O11+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF021N09+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF041A11+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACNGACAAAACAATAAAGTGTA
JMSF023A22+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF012I02+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF003G10+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF006K13+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
JMSF036F16+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAANCAATAAAGTGTA
JMSF001G13+ ACAGACAAACCAATAAAGTGTA
JMSF010I18+ AGTGTA
JMFF043B10+ CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
                      ____________________________________________________________
consensus CAGAACAAAATACTCAATAGCGCCCAGCACTAAAAACCACAGACAAAACAATAAAGTGTA
 
. : . : . : . : . : . :
JMSF046H16+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF042M21+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF041A15+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF035A17+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF050M16+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF032M09+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF038I08+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF023O20+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF032E18+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF033M24+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF026I01+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF049M10+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF026J13+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF026P10+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF035M20+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF033N05+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF052P10+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF040O11+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF021N09+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF041A11+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF023A22+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF012I02+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF003G10+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF006K13+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF036F16+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF008L16+ TCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF001G13+ AAGCTGANTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMSF010I18+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
JMFF043B10+ AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
                      ____________________________________________________________
consensus AAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTTGTGCCAGCGCCAGCCC
 
. : . : . : . : . : . :
JMSF046H16+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF042M21+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF041A15+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF035A17+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF050M16+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF032M09+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF038I08+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF023O20+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF032E18+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF033M24+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF026I01+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF049M10+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF026J13+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF026P10+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF035M20+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF033N05+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF052P10+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF040O11+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF021N09+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF041A11+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF023A22+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF012I02+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF003G10+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF006K13+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF036F16+ CAGTGNGGGGGCGGGCANCAGCAGGCNAGAGAGGAAAGCCATCAGCAAAATGCCTGTTGC
JMSF008L16+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF019O21+ CAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF001G13+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMSF010I18+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
JMFF043B10+ CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
                      ____________________________________________________________
consensus CAGTGCGGGGGCGGGCAGCAGCAGGCAAGAGAGGAAAGCCATCAGCAAAATGCCTGCTGC
 
. : . : . : . : . : . :
JMSF046H16+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF042M21+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF041A15+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF035A17+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF050M16+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF032M09+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF038I08+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF023O20+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF032E18+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF033M24+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF026I01+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF049M10+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF026J13+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF026P10+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF035M20+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF033N05+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF052P10+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF040O11+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF021N09+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF041A11+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF023A22+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF012I02+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF003G10+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF006K13+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF036F16+ GGTGGTCAAGGTTTNTAAAGGGTGTTTCATAACATTGTTAAANGTAAGTTAAAACACCAT
JMSF008L16+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF019O21+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF001G13+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMSF010I18+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
JMFF043B10+ GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
                      ____________________________________________________________
consensus GGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCAT
 
. : . : . : . : . : . :
JMSF046H16+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF042M21+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF041A15+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF035A17+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF050M16+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF032M09+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF038I08+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF023O20+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF032E18+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF033M24+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF026I01+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF049M10+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF026J13+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF026P10+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF035M20+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF033N05+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF052P10+ TGTCAGGGATATTNTTCTGTAAGGCAA-TTCCCGGNTTAGTCACCGGCCCAGATCTCACA
JMSF040O11+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF021N09+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF041A11+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCNCCGGCCCAGATCTCACA
JMSF023A22+ TGTCAGGGATATTNTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF012I02+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF003G10+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF006K13+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF036F16+ TNTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGNTTAGTCACCGGCCCAGATCTCACA
JMSF008L16+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF019O21+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF001G13+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF010I18+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF015M13+ TCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMSF017A18+ TCAGGGATATTCTTCTGTAAGGCAATTTCCCGGCTTAGTCACCGGCCCAGATCTCACA
JMFF043B10+ TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
                      ____________________________________________________________
consensus TGTCAGGGATATTCTTCTGTAAGGCAA-TTCCCGGCTTAGTCACCGGCCCAGATCTCACA
 
. : . : . : . : . : . :
JMSF046H16+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF042M21+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGNTG
JMSF041A15+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF035A17+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF050M16+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF032M09+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF038I08+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF023O20+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF032E18+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF033M24+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF026I01+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF049M10+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF026J13+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF026P10+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF035M20+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF033N05+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF052P10+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGNTG
JMSF040O11+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF021N09+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF041A11+ ATGCTTTTTCACCAGCNCAATCAGCGAGCCGCCATCGGCGACGAAATCGNGCATTAGCTG
JMSF023A22+ ATGCTTTTTCACCAGCCCAATCANCGAGCCGCCATCGGCGACGAAATCGCGC
JMSF012I02+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF003G10+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF006K13+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF036F16+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF008L16+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF019O21+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF001G13+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF010I18+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF015M13+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMSF017A18+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
JMFF043B10+ ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
                      ____________________________________________________________
consensus ATGCTTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGCGCATTAGCTG
 
. : . : . : . : . : . :
JMSF046H16+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF042M21+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF041A15+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF035A17+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF050M16+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF032M09+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF038I08+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF023O20+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTC
JMSF032E18+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF033M24+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF026I01+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTC
JMSF049M10+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF026J13+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF026P10+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF035M20+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF033N05+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF052P10+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCT
JMSF040O11+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTC
JMSF021N09+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF041A11+ CGNTTCATTCAGACCGNTGACGACCTGGCGATGCAGGG
JMSF012I02+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF003G10+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF006K13+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF036F16+ CGCTTCATTCAGACCGC
JMSF008L16+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF019O21+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF001G13+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAT
JMSF010I18+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF015M13+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMSF017A18+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCA
JMFF043B10+ CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAATCGCGCTCGATGCACC
                      ____________________________________________________________
consensus CGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCATTCGCGCTCGATGCACC
 
. : . : . : . : . : . :
JMFF043B10+ AATTTTATGTGCGGAAGGGGCGATTTTTTCCAGCAATCGCAAGGTATCTTCCGTTAGCGG
                      ____________________________________________________________
consensus AATTTTATGTGCGGAAGGGGCGATTTTTTCCAGCAATCGCAAGGTATCTTCCGTTAGCGG