Previous Contig 001832:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020K04Sequence511001832 (7)769010276 (7)gb:AB020749_15146383e-43Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMFF043B08Sequence631001832 (7)gb:AY045931_15614292e-07Arabidopsis thaliana putative mitogen-activated protein kinase (At1g18150) mRNA,649010276 (7)gb:AB020749_15146387e-11Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMSF004I20Sequence297001832 (7)202010926 (4)
JMSF012L10Sequence521001832 (7)gb:AY045931_15614290.003Arabidopsis thaliana putative mitogen-activated protein kinase (At1g18150) mRNA,755010276 (7)gb:AB020749_15146384e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMSF013O01Sequence360001832 (7)732010276 (7)gb:AB020749_15146384e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMSF040O13Sequence531001832 (7)
JMSF045L20Sequence686001832 (7)gb:AY045931_15614295e-39Arabidopsis thaliana putative mitogen-activated protein kinase (At1g18150) mRNA,702010276 (7)gb:AB020749_15146382e-35Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045L20+ TCTCAGAATTCTGGNGGCATCAGAAACATGTTCAAACACATCATTGAT
                      ____________________________________________________________
consensus TCTCAGAATTCTGGNGGCATCAGAAACATGTTCAAACACATCATTGAT
 
. : . : . : . : . : . :
JMSF045L20+ CTTCTTAATTGCAACTCGTTCTCCAGATTGAGTATCAACTGCGGACCCCACAACTCCATA
                      ____________________________________________________________
consensus CTTCTTAATTGCAACTCGTTCTCCAGATTGAGTATCAACTGCGGACCCCACAACTCCATA
 
. : . : . : . : . : . :
JMSF045L20+ GCTACCTTTTCCAATAATTTCTTGAACTTGATACCTACTTGCCTCTCCATACTCCGTAAA
                      ____________________________________________________________
consensus GCTACCTTTTCCAATAATTTCTTGAACTTGATACCTACTTGCCTCTCCATACTCCGTAAA
 
. : . : . : . : . : . :
JMSF045L20+ GAAGTCAGACTCCAGGTTACTCTTTCTGTGAGGATCCATGAAGGAAACTGGGAAATTGAC
                      ____________________________________________________________
consensus GAAGTCAGACTCCAGGTTACTCTTTCTGTGAGGATCCATGAAGGAAACTGGGAAATTGAC
 
. : . : . : . : . : . :
JMSF045L20+ ACGTTTGGGGACCTTGATCGAACTCAGCCCTGAAATATCAAAGTCTTCTACTATTCTAAG
JMSF040O13+ GAAATATCAAAGTNTTNTANTATTNTAAG
JMSF012L10+ AATATCAAAGTCTTCTACTATTNTAAG
JMFF043B08+ GAAATATCAAAGTCTTCTACTATTCTAAG
                      ____________________________________________________________
consensus ACGTTTGGGGACCTTGATCGAACTCAGCCCTGAAATATCAAAGTCTTCTACTATTCTAAG
 
. : . : . : . : . : . :
JMSF045L20+ CTGCTCTTCCTCTACTTCTCCACGGTTTTTGGAATAATTGCTAGAATAATTAGTGGGCTT
JMSF040O13+ NTGCTCTTCCTNTANTTNTCCACGGTTTTNGGAATAANNGNTAGAATAATTAGNGGGCNN
JMSF012L10+ CTGCTCTTCCTCTACTTCTCCACGGTTTTTGGAATAATTGCTAGAATAATTAGTGGGCTT
JMFF020K04+ TTGGAATAATTGCTAGAATAATTAGTGGGCTT
JMSF013O01+ TGCTAGAATAATTAGTGGGCTT
JMFF043B08+ CTGCTCTTCCTCTACTTCTCCACGGTTTTTGGAATAATTGCTAGAATAATTAGTGGGCTT
                      ____________________________________________________________
consensus CTGCTCTTCCTCTACTTCTCCACGGTTTTTGGAATAATTGCTAGAATAATTAGTGGGCTT
 
. : . : . : . : . : . :
JMSF045L20+ GTGAGAATGGGTCAGAACAGAATCCGCATTTGCGCTAGGAGGAGCAGATGGACGACGATG
JMSF040O13+ GTGAGAANGGGTCAGAACAGAATCCGCATTTGCGNTAGGAGGAGCAGATGGACGANGATG
JMSF012L10+ GTGAGAATGGGTCAGAACAGAATCCGCATTTGCGCTAGGAGGAGCAGATGGACGACGATG
JMFF020K04+ GTGATAATGGGTCAGAACAGAATCCGCATTTGCGCTAGGAGGAGCAGATGGACGACGATG
JMSF013O01+ GTGAGAATGGGTCAGAACAGAATCCGCATTTGCGCTAGGAGGAGCAGATGGACGACGATG
JMFF043B08+ GTGATAATGGGTCAGAACAGAATCCGCATTTGCGCTAGGAGGAGCAGATGGACGACGATG
                      ____________________________________________________________
consensus GTGAGAATGGGTCAGAACAGAATCCGCATTTGCGCTAGGAGGAGCAGATGGACGACGATG
 
. : . : . : . : . : . :
JMSF045L20+ GAACCAGCGAAGAACACCATCCACAAATGCATTCCCACCCCCCATATACTACTTTAGTGC
JMSF040O13+ GAACCAGCGAAGAACACCATCCACAAATGCATTCCCACCCCCCATATACTACTTTAGTGC
JMSF012L10+ GAACCAGCGAAGAACACCATCCACAAATGCATTCCCACCCCCCATATACTACTTTAGTGC
JMFF020K04+ GAACCAGCGAAGAACACCATCCACAAATGCATTCCCACCCCCCATATACTACTTTAGTGC
JMSF013O01+ GAACCAGCGAAGAACACCATCCACAAATGCATTCCCACCCCCCATATACTACTTTAGTGC
JMFF043B08+ GAACCAGCGAAGAACACCATCCACAAATGCATTCCCACCCCCCATATACTACTTTAGTGC
                      ____________________________________________________________
consensus GAACCAGCGAAGAACACCATCCACAAATGCATTCCCACCCCCCATATACTACTTTAGTGC
 
. : . : . : . : . : . :
JMSF045L20+ TTCTCTTTTCTTTTTTTTGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
JMSF040O13+ TTCTCTTTTCTTTTTTTTGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
JMSF012L10+ TTCTCTTTTCTTTTTTNTGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
JMSF004I20+ TGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
JMFF020K04+ TTCTCTTTTCTTTTTTTTGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
JMSF013O01+ TTCTCTTTTCTTTTTTTTGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
JMFF043B08+ TTCTCTTTTCTTTTTTNTGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
                      ____________________________________________________________
consensus TTCTCTTTTCTTTTTTTTGCGTCGTTCCTATTCCTATCCCTCCCCTAAACTCTCGATCCA
 
. : . : . : . : . : . :
JMSF045L20+ ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
JMSF040O13+ ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
JMSF012L10+ ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
JMSF004I20+ ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
JMFF020K04+ ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
JMSF013O01+ ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
JMFF043B08+ ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
                      ____________________________________________________________
consensus ATTCCTGATTCTCTACCACTCGATCTCAGCTCTCTCTCTCTCTCTCTCTCTTCGTGCTCC
 
. : . : . : . : . : . :
JMSF045L20+ GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
JMSF040O13+ GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
JMSF012L10+ GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
JMSF004I20+ GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
JMFF020K04+ GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
JMSF013O01+ GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
JMFF043B08+ GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
                      ____________________________________________________________
consensus GAACCTTTCTTCCGATTCTCTCTCAATCGATGAAGGGCGACAAGGAAGATCGAGGGTGAG
 
. : . : . : . : . : . :
JMSF045L20+ AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGA
JMSF040O13+ AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGAC
JMSF012L10+ AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGACATTGACTACCGCGTTAAGGCTAC
JMSF004I20+ AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGACATTGACTACCGCGTTAAGGCTAC
JMFF020K04+ AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGACATTGACTACCGCGTTAAGGCTAC
JMSF013O01+ AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGAC
JMFF043B08+ AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGACATTGACTACCGCGTTAAGGCTAC
                      ____________________________________________________________
consensus AAATGCGATTAAAGTATAATAGGAAAGAAGCTTGGACATTGACTACCGCGTTAAGGCTAC
 
. : . : . : . : . : . :
JMSF012L10+ TTCTTTATTATGTCGCATTTCGCAATCGCAGAAAGGATTTTTTTTCCATTCCTATTCCTT
JMSF004I20+ TTCTTTATTATGTCGCATTTCGCAATCGCAGAAAGGATTTTTTTTCCATTCCTATTCCTT
JMFF020K04+ TTCTTTATTATGTCGCATTTCGCAATCGCAGAAAGGATTTTTTTTCCATTCCTATTCCTT
JMFF043B08+ TTCTTTATTATGTCGCATTTCGCAATCGCAGAAAGGATTTTTTTTCCATTCCTATTCCTT
                      ____________________________________________________________
consensus TTCTTTATTATGTCGCATTTCGCAATCGCAGAAAGGATTTTTTTTCCATTCCTATTCCTT
 
. : . : . : . : . : . :
JMSF012L10+ GCCTTCTTCTCAT
JMSF004I20+ GCCTTCTTCTCAT
JMFF020K04+ GCCTTCTTCTCATAGACGTTACTTTACTTACATTTTATCTAAATATCTATTTCTCAGAC
JMFF043B08+ GCCTTCTTCTCATAGACGTTACTTTACTTACATTTTATCTAAATATCTATTTCTCAGACC
                      ____________________________________________________________
consensus GCCTTCTTCTCATAGACGTTACTTTACTTACATTTTATCTAAATATCTATTTCTCAGACC