Previous Contig 001831:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043B05Sequence647001831 (3)gb:AP005804_18581446e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN647010275 (4)gb:AP005804_18581442e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFS089F10Sequence624001831 (3)gb:AP005804_18581441e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFS149F06Sequence633001831 (3)gb:AP005804_18581444e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS089F10+ CCTTTATCAACTTAGGGGAGATGGAGACAAGAATAGATTGAGCAACA
JMFS149F06+ AGTTATTCCCTTTATCAACTTAGGGGAGATGGAGACAAGAATAGATTGAGCAACA
JMFF043B05+ CCTTTATCAACTTAGGGGAGATGGAGACAAGAATAGATTGAGCAACA
                      ____________________________________________________________
consensus AGTTATTCCCTTTATCAACTTAGGGGAGATGGAGACAAGAATAGATTGAGCAACA
 
. : . : . : . : . : . :
JMFS089F10+ GATGAAGGAACTTCAGAAACAATTGTCTTCAATGCTATGCTTGCAATGTCTCTGTGTTGT
JMFS149F06+ GATGAAGGAACTTCAGAAACAATTGTCTTCAATGCTATGCTTGCAATGTCTCTGTGTTGT
JMFF043B05+ GATGAAGGAACTTCAGAAACAATTGTCTTCAATGCTATGCTTGCAATGTCTCTGTGTTGT
                      ____________________________________________________________
consensus GATGAAGGAACTTCAGAAACAATTGTCTTCAATGCTATGCTTGCAATGTCTCTGTGTTGT
 
. : . : . : . : . : . :
JMFS089F10+ TCTTTCCCATTGAGCAGTTTATCACAAAGCCTGTCTGTCATGTCCAAGACTTGTTGCTCG
JMFS149F06+ TCTTTCCCATTGAGCAGTTTATCACAAAGCCTGTCTGTCATGTCCAAGACTTGTTGCTCG
JMFF043B05+ TCTTTCCCATTGAGCAGTTTATCACAAAGCCTGTCTGTCATGTCCAAGACTTGTTGCTCG
                      ____________________________________________________________
consensus TCTTTCCCATTGAGCAGTTTATCACAAAGCCTGTCTGTCATGTCCAAGACTTGTTGCTCG
 
. : . : . : . : . : . :
JMFS089F10+ CGAACTTTCTTCACAAGAGGTGCAAGGCATTTTACAGCCAATCCAGAAACATCACCAGCT
JMFS149F06+ CGAACTTTCTTCACAAGAGGTGCAAGGCATTTTACAGCCAATCCAGAAACATCACCAGCT
JMFF043B05+ CGAACTTTCTTCACAAGAGGTGCAAGGCATTTTACAGCCAATCCAGAAACATCACCAGCT
                      ____________________________________________________________
consensus CGAACTTTCTTCACAAGAGGTGCAAGGCATTTTACAGCCAATCCAGAAACATCACCAGCT
 
. : . : . : . : . : . :
JMFS089F10+ GCATCATCTAGCTGCTGCAAAACAACATTTGACAGCTTTGCTTCAAGTTCAGCATCAAGT
JMFS149F06+ GCATCATCTAGCTGCTGCAAAACAACATTTGACAGCTTTGCTTCAAGTTCAGCATCAAGT
JMFF043B05+ GCATCATCTAGCTGCTGCAAAACAACATTTGACAGCTTTGCTTCAAGTTCAGCATCAAGT
                      ____________________________________________________________
consensus GCATCATCTAGCTGCTGCAAAACAACATTTGACAGCTTTGCTTCAAGTTCAGCATCAAGT
 
. : . : . : . : . : . :
JMFS089F10+ TTAAATCCCTCTTTGTTCAGTTCATTTAGCAAATCAGAAGTTGCCATGTATCTGTAATCC
JMFS149F06+ TTAAATCCCTCTTTGTTCAGTTCATTTAGCAAATCAGAAGTTGCCATGTATCTGTAATCC
JMFF043B05+ TTAAATCCCTCTTTGTTCAGTTCATTTAGCAAATCAGAAGTTGCCATGTATCTGTAATCC
                      ____________________________________________________________
consensus TTAAATCCCTCTTTGTTCAGTTCATTTAGCAAATCAGAAGTTGCCATGTATCTGTAATCC
 
. : . : . : . : . : . :
JMFS089F10+ TTATCCTTCCCAGTCATCTTCTCAAGTATCGTAGTTATGGCCATATTTGCCATTGTTGCA
JMFS149F06+ TTATCCTTCCCAGTCATCTTCTCAAGTATCGTAGTTATGGCCATATTTGCCATTGTTGCA
JMFF043B05+ TTATCCTTCCCAGTCATCTTCTCAAGTATCGTAGTTATGGCCATATTTGCCATTGTTGCA
                      ____________________________________________________________
consensus TTATCCTTCCCAGTCATCTTCTCAAGTATCGTAGTTATGGCCATATTTGCCATTGTTGCA
 
. : . : . : . : . : . :
JMFS089F10+ AACCTCTATAGATGTACTTTTCCTGAGATTCACCAAAAGGTGATAACAGCTTGTTGGTTC
JMFS149F06+ AACCTCTATAGATGTACTTTTCCTGAGATTCACCAAAAGGTAATAACAGCTTGTTGGTTC
JMFF043B05+ AACCTCTATAGATGTACTTTTCCTGAGATTCACCAAAAGGTGATAACAGCTTGTTGGTTC
                      ____________________________________________________________
consensus AACCTCTATAGATGTACTTTTCCTGAGATTCACCAAAAGGTGATAACAGCTTGTTGGTTC
 
. : . : . : . : . : . :
JMFS089F10+ GCAGTGGGGCTGTGGATGAGGACCTCACATCCAAGTGGCAAGCGCCGAGTGCGTGTAGGT
JMFS149F06+ GCAGTGGGGCTGTGGATGAGGACCTCACATCCAAGTGGCAAGCGCCGAGTGCGTGTAGGT
JMFF043B05+ GCAGTGGGGCTGTGGATGAGGACCTCACATCCAAGTGGCAAGCGCCGAGTGCGTGTAGGT
                      ____________________________________________________________
consensus GCAGTGGGGCTGTGGATGAGGACCTCACATCCAAGTGGCAAGCGCCGAGTGCGTGTAGGT
 
. : . : . : . : . : . :
JMFS089F10+ ATAACGTAAAGTGTGCGGTATGATCGATCCGTATTAGGGTTGCTTTTCGCCTTAAACCCT
JMFS149F06+ ATAACGTAAAGTGTGCGGTATGATCGATCCGTATTAGGGTTGCTTTTCGCCTTAAACCCT
JMFF043B05+ ATAACGTAAAGTGTGCGGTATGATCGATCCGTATTAGGGTTGCTTTTCGCCTTAAACCCT
                      ____________________________________________________________
consensus ATAACGTAAAGTGTGCGGTATGATCGATCCGTATTAGGGTTGCTTTTCGCCTTAAACCCT
 
. : . : . : . : . : . :
JMFS089F10+ GTGAGGGAGTGATGTCAGAGAGCAGAGGCGTGGCG
JMFS149F06+ GTGAGGGAGTGATGTCAGAGAGCAGAGGCGTGGCG
JMFF043B05+ GTGAGGGAGTGATGTCAGAGAGCAGAGGCGTGGCGGAGTGAGTTACCCAGTGGCTATGTC
                      ____________________________________________________________
consensus GTGAGGGAGTGATGTCAGAGAGCAGAGGCGTGGCGGAGTGAGTTACCCAGTGGCTATGTC