Previous Contig 001813:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016O08Sequence531001813 (8)
JMFF034E05Sequence451001813 (8)769010236 (2)gb:AP003376_18287434e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFF042J09Sequence644001813 (8)520010236 (2)gb:AP003376_18287431e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFS025G03Sequence620001813 (8)
JMFS026D02Sequence642001813 (8)
JMFS037G11Sequence537001813 (8)
JMFS053A08Sequence569001813 (8)
JMFS078C05Sequence641001813 (8)gb:AY080703_15684252e-48Arabidopsis thaliana putative casein kinase (At3g13670) mRNA, complete cds.>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS078C05+ CCAAGCATATCCATTACCATTATATAATAATCACCTTGTTGGCCTTTATAG
                      ____________________________________________________________
consensus CCAAGCATATCCATTACCATTATATAATAATCACCTTGTTGGCCTTTATAG
 
. : . : . : . : . : . :
JMFS078C05+ TGCACTCGCGGTACACCATGACTGCCCCCAAGAGTGTTGTAAACCTGCCATTCATAAGGT
                      ____________________________________________________________
consensus TGCACTCGCGGTACACCATGACTGCCCCCAAGAGTGTTGTAAACCTGCCATTCATAAGGT
 
. : . : . : . : . : . :
JMFS078C05+ GGTCCATAGCTGCATCCTTTACCATTTCGATGCTCAAATTTCAAAGCCACTTCTATTGCT
                      ____________________________________________________________
consensus GGTCCATAGCTGCATCCTTTACCATTTCGATGCTCAAATTTCAAAGCCACTTCTATTGCT
 
. : . : . : . : . : . :
JMFS078C05+ CCAGGGCCGGTTCTGTCAATTGCATTACCACCAGAAATACGGCGACCAACATAGACTTGT
                      ____________________________________________________________
consensus CCAGGGCCGGTTCTGTCAATTGCATTACCACCAGAAATACGGCGACCAACATAGACTTGT
 
. : . : . : . : . : . :
JMFS078C05+ CCAAAGCCTCCTTTGCCAAGCTTTCTTTCTATCTTGTATAGTGGTGAACCACCTACTTGA
JMFS025G03+ CTACTTGA
                      ____________________________________________________________
consensus CCAAAGCCTCCTTTGCCAAGCTTTCTTTCTATCTTGTATAGTGGTGAACCACCTACTTGA
 
. : . : . : . : . : . :
JMFS078C05+ ACCTTTTCAGGAAGGGGGGCTGCGCTCCCATCATCCTCAGCAGCATGACCTTTTTCAGGG
JMFS025G03+ ACCTTTTCAGGAAGGGGGGNTGCGCTCCCATCATCCTCAGCAGCATGACCTTTTTCAGGG
JMFS026D02+ CAGCAGCATGACC-TTTTCAGGG
                      ____________________________________________________________
consensus ACCTTTTCAGGAAGGGGGGCTGCGCTCCCATCATCCTCAGCAGCATGACCTTTTTCAGGG
 
. : . : . : . : . : . :
JMFS078C05+ CTCTTAGCACCACTATCAAAATCATCCATGGCCTTGTCGCCAACTTCCTCTCTCTTCTTA
JMFS025G03+ CTCTTAGCACCACTATCAAAATCATCCATGGCCTTGTCGCCAACTTCCTCTCTCTTCTTA
JMFS053A08+ TCTCTCTTCTTA
JMFF016O08+ CTTCTTA
JMFS026D02+ CTCTTAGCACCACTATCANAATCATCCATGGCCTGGTCGCCAACTTCCTCTCTCTTCTTA
JMFF042J09+ AATCATCCATGGCCTTGTCGCCAACTTCCTCTCTC-TCTTA
                      ____________________________________________________________
consensus CTCTTAGCACCACTATCAAAATCATCCATGGCCTTGTCGCCAACTTCCTCTCTCTTCTTA
 
. : . : . : . : . : . :
JMFS078C05+ GCTCGAACTGCTTCTTCCTTCTCTACAGCTCGACCCTCCGCCGCCGCCGCCGCTGCAGCT
JMFS025G03+ GCTCGAACTGCTTCTTCCTTCTCTACAGCTCGACCCTCCGCCGCCGCCGCCGCTGCAGCT
JMFS053A08+ GCTCGAACTGCTTCTTCCTTCTNTACAGCTNGACCCTCCGCCGCCGCCGCCGCTGCAGCT
JMFF034E05+ TCTACAGCTCGACCCTCCGCCGCCGCCGCCGCTGCAGCT
JMFF016O08+ GCTCGAACTGCTTCTTCCTTCTCTACAGCTCGACCCTCCGCCGCCGCCGCCGCTGCAGCT
JMFS026D02+ GCTCGAACTGCTTCTTCCTTCTNTACAGCTNGACCCTCCGCCGCCGCCGCCGCTGCAGCT
JMFS037G11+ CGCCGCCGCCGCCGNTGCAGNT
JMFF042J09+ GCTCGAACTGCTTCTTCCTTCTTTACAGCTCGACCCTCCGCCGCCGCCGCCGCTGCAGCT
                      ____________________________________________________________
consensus GCTCGAACTGCTTCTTCCTTCTCTACAGCTCGACCCTCCGCCGCCGCCGCCGCTGCAGCT
 
. : . : . : . : . : . :
JMFS078C05+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
JMFS025G03+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
JMFS053A08+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
JMFF034E05+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
JMFF016O08+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
JMFS026D02+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
JMFS037G11+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
JMFF042J09+ GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
                      ____________________________________________________________
consensus GCAGGTGGTATCCGACCTACGTTCTCATCCACAGGCGGCGTCGCCGCCGCCGCTGCCGCC
 
. : . : . : . : . : . :
JMFS078C05+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
JMFS025G03+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
JMFS053A08+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
JMFF034E05+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
JMFF016O08+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
JMFS026D02+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
JMFS037G11+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
JMFF042J09+ GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
                      ____________________________________________________________
consensus GCTCTCCTCCTCCTGGTCCTCGCAGCAATCGCCTCACCCTCAATCGGAGTCTGGTCGTTA
 
. : . : . : . : . : . :
JMFS078C05+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCC
JMFS025G03+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
JMFS053A08+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
JMFF034E05+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
JMFF016O08+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
JMFS026D02+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
JMFS037G11+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
JMFF042J09+ TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
                      ____________________________________________________________
consensus TTAGTGTTCGGCTGTGTCTCCGCCTCTGGCTGCTGCTTCGGTCTCCGGCCTCTGCGCGCT
 
. : . : . : . : . : . :
JMFS025G03+ CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
JMFS053A08+ CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
JMFF034E05+ CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
JMFF016O08+ CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
JMFS026D02+ CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
JMFS037G11+ CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
JMFF042J09+ CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
                      ____________________________________________________________
consensus CCACCACGCAGCACTGGCATCGTTCATCGTCCGATTCTCATCCTCTCAATTCTCAAACCC
 
. : . : . : . : . : . :
JMFS025G03+ TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
JMFS053A08+ TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
JMFF034E05+ TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
JMFF016O08+ TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
JMFS026D02+ TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
JMFS037G11+ TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
JMFF042J09+ TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
                      ____________________________________________________________
consensus TAATGAATTTATCACAACGCCCACTCTCTTCCTCCGCACACACTAAACAAAACCTTACCA
 
. : . : . : . : . : . :
JMFS025G03+ ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
JMFS053A08+ ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
JMFF034E05+ ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
JMFF016O08+ ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
JMFS026D02+ ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
JMFS037G11+ ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
JMFF042J09+ ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
                      ____________________________________________________________
consensus ATATAATAATACGCGTTTTTCCAGAAAACCTATCCCAGAAAAGAATCGAAGCTTAAAGAG
 
. : . : . : . : . : . :
JMFS025G03+ AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTT-ATGATCACAG
JMFS053A08+ AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTTGATGATCACAG
JMFF034E05+ AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTTGAT
JMFF016O08+ AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTTGATGATCACAG
JMFS026D02+ AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTTGATGATCACAG
JMFS037G11+ AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTTGATGATCACAG
JMFF042J09+ AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTTGATGATCACAG
                      ____________________________________________________________
consensus AAGAGTAGCGATCGACGAGTATATAAACACGAGAGAGCTGAAAGCAGTTGATGATCACAG
 
. : . : . : . : . : . :
JMFS025G03+ AAG
JMFS053A08+ AAGAATTAGCGTTTCGTGGGTTAAAGAGGATTAGGGATCTGTACAGTTTTGGAAAAATGA
JMFF016O08+ AAGAATTAGCGTTTCGTGGGTTAAAGAGGATTAGGGATCTGTAC
JMFS026D02+ AAGAATTAGCGTTTCGTGGGTTAAAGAGGATTAGGGATCTGTACAGTTTTGGAAAAATGA
JMFS037G11+ AAGAATTAGCGTTTCGTGGGTTAAAGAGGATTAGGGATCTGTACAGTTTTGGAAAAATGA
JMFF042J09+ AAGAATTAGCGTTTCGTGGGTTAAAGAGGATTAGGGATCTGTACAGTTTTGGAAAAATGA
                      ____________________________________________________________
consensus AAGAATTAGCGTTTCGTGGGTTAAAGAGGATTAGGGATCTGTACAGTTTTGGAAAAATGA
 
. : . : . : . : . : . :
JMFS053A08+ GGAAAGAAAGAGAGAGA
JMFS026D02+ GGAAAGAAAGAGAGAGA
JMFS037G11+ GGAAAGAAAGAGAGAGAAAGAGGAAGAAAGAGAGA
JMFF042J09+ GGAAAGAAAGAGAGAGAAAGAGGAAGAAAGAGAGACAGACGAATAGAGAGAGAGAGATAT
                      ____________________________________________________________
consensus GGAAAGAAAGAGAGAGAAAGAGGAAGAAAGAGAGACAGACGAATAGAGAGAGAGAGATAT