Previous Contig 001812:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035L05Sequence507001812 (4)pir|T48935|T489353e-47acyl CoA reductase-like protein - Arabidopsis thaliana>gb:ATF14L2_1548586 Arabid702021469gb:AF149917_17725434e-65Simmondsia chinensis acyl CoA reductase mRNA, complete cds.>gb:AF149918_2141742
JMFF042I07Sequence659001812 (4)gb:AY057657_15640704e-61Arabidopsis thaliana AT4g33790/T16L1_280 mRNA, complete cds.>gb:AY070065_1566707591011180 (2)gb:AF149917_17725433e-43Simmondsia chinensis acyl CoA reductase mRNA, complete cds.>gb:AF149918_2141742
JMSF002A06Sequence264001812 (4)gb:AY057657_15640709e-23Arabidopsis thaliana AT4g33790/T16L1_280 mRNA, complete cds.>gb:AY070065_1566707741011180 (2)gb:AF149917_17725433e-58Simmondsia chinensis acyl CoA reductase mRNA, complete cds.>gb:AF149918_2141742
JMSF031H17Sequence643001812 (4)gb:AY057657_15640704e-64Arabidopsis thaliana AT4g33790/T16L1_280 mRNA, complete cds.>gb:AY070065_1566707

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031H17+ TTATCTCATTCTCCCTATCAATGTCCAGCCCACATCTTCC
                      ____________________________________________________________
consensus TTATCTCATTCTCCCTATCAATGTCCAGCCCACATCTTCC
 
. : . : . : . : . : . :
JMSF031H17+ ATTCAGTGTTTCACCCATTTGGAATGGTGTCTCCTGTAACAGCCCATCCCTTTCACCAGA
JMFF042I07+ TTCAGTGTTTCACCCATTTGGTATGGAGTCTCCTGTATCAACCCCTCCTTTTCACCAGA
                      ____________________________________________________________
consensus ATTCAGTGTTTCACCCATTTGGTATGGTGTCTCCTGTATCAGCCCCTCCTTTTCACCAGA
 
. : . : . : . : . : . :
JMSF031H17+ CACGTAAGCAGTGGATACGTGAAGAAAAACCTTTAATTTCCGGCATTTTTTGGCGAAGTC
JMFF042I07+ CACGTAGGCAGTGGATACGTGGAGAAGAATCCTTAAATTTTGACATTTCTTGGCGAAGTC
                      ____________________________________________________________
consensus CACGTAGGCAGTGGATACGTGGAGAAGAATCTTTAATTTTTGGCATTTTTTGGCGAAGTC
 
. : . : . : . : . : . :
JMSF031H17+ TAGTAAGTGTGTTGGTCCCATTGTATTAATCCCAATGGCCACATCATATCTTTCATAAAA
JMFF042I07+ TAGTATGTGTTTAGGTCCCATTGTATTAATCCCCATGGCAACATCGTATCTTTCATCAAA
                      ____________________________________________________________
consensus TAGTATGTGTTTTGGTCCCATTGTATTAATCCCCATGGCCACATCGTATCTTTCATCAAA
 
. : . : . : . : . : . :
JMSF031H17+ ATCAGTAGTTGCAGCTAGGTTAACCATAATGTCTACTTCCCTCTGCATTTGGTCCAGCAG
JMFF042I07+ ACTGGTAGTTGCAGCTAGGTTAACCACAACATCTACTTCCCTCCACATTTGGTCCAGCAA
                      ____________________________________________________________
consensus ATTGGTAGTTGCAGCTAGGTTAACCATAATGTCTACTTCCCTCTGCATTTGGTCCAGCAG
 
. : . : . : . : . : . :
JMSF031H17+ ATGAGAGTCCTTTACGCCCATCTTCTCACAACTAACATCACCGGCTACAACACTCACCTT
JMFF042I07+ ATTGGTGTCCTTTATGCCCAAATTTTGGTACGTAATGTCACCGCCCACAACAATTATTTT
                      ____________________________________________________________
consensus ATTGGTGTCCTTTATGCCCATCTTTTGGTACGTAATGTCACCGGCTACAACACTTATTTT
 
. : . : . : . : . : . :
JMSF031H17+ TTCCGATATTATATTATTCAAC---TTTTCCCCATACTTCTCCTTCACAACTTTGAACAA
JMSF002A06+ TTCACAACTTTAAACAA
JMFF035L05+ TTCACAACTTTGAACAA
JMFF042I07+ TGACGAAATTAGGGAATTCAGCTCTTCTTCTCCATACTTGTGTTTCACAACTTTAAACAA
                      ____________________________________________________________
consensus TTCCGATATTATGTTATTCAGCTCTTTTTCTCCATACTTGTGTTTCACAACTTTGAACAA
 
. : . : . : . : . : . :
JMSF031H17+ GTCTTTTGCCATAACCTCGGAGTTAAAACGCTGCACGGCGGCCATTGTATCTGCAGCTCT
JMSF002A06+ GTCTTTTGCCATTACCTCGGAGTTGAAACGCTGTACGGCGGCGGCGGTATCTGCAGCTCT
JMFF035L05+ GTCTTTTGCCATAACCTCGGAGTTAAAACGCTGCACGGCGGCCATTGTATCTGCAGCTCT
JMFF042I07+ GTCTTTTGCCATTACCTCGGAGTTGAAACGCTGTACGGCGGCGGCGGTATCTGCAGCTCT
                      ____________________________________________________________
consensus GTCTTTTGCCATTACCTCGGAGTTGAAACGCTGTACGGCGGCGGTTGTATCTGCAGCTCT
 
. : . : . : . : . : . :
JMSF031H17+ CAGGAGAAGATACAGCTTCTTCACATTTGGCTGAACTCTCAGTATTTTCTCCACAAAAAT
JMSF002A06+ AAGGAGAAGATACAGTTTCTTCACATTTGGCTGAACTCTCAGTATTTTCTCCACAAAAAT
JMFF035L05+ CAGGAGAAGATACAGCTTCTTCACATTTGGCTGAACTCTCAGTATTTTCTCCACAAAAAT
JMFF042I07+ AAGGAGAAGATACAGTTTCTTCACATTTGGCTGAACTCTCAGTATTTTCTCCACAAAAAT
                      ____________________________________________________________
consensus CAGGAGAAGATACAGTTTCTTCACATTTGGCTGAACTCTCAGTATTTTCTCCACAAAAAT
 
. : . : . : . : . : . :
JMSF031H17+ TTTAGCGAGAAAGCCAGTGGCACCAGTGACAAGAATGGCTCTGTTCTCAAAAAACTCCAC
JMSF002A06+ TTTTGCTAAGAAGCCAGTGGCGCCGGTGACAAGAATGGCTCTGTTGTCCAGAAAGTGAAG
JMFF035L05+ TTTAGCGAGAAAGCCAGTGGCACCAGTGACAAGAATGGCTCTGTTCTCCAAAAACTCCAC
JMFF042I07+ TTTTGCTAAGAAGCCAGTGGCGCCGGTGAGAAGAATGGCTCTGTTGTCCAGAAAGTGAAG
                      ____________________________________________________________
consensus TTTTGCTAGGAAGCCAGTGGCGCCGGTGACAAGAATGGCTCTGTTGTCCAGAAAGTGCAG
 
. : . : . : . : . : . :
JMSF031H17+ AGCACTGCCCAACTCCATT
JMSF002A06+ AGCACTGCCCAACTCCATT
JMFF035L05+ AGCACTGCCCAACTCCATT
JMFF042I07+ AGCACTGCCCAACTCCATTGTAGAAGTGGAAGGATCGGAGGAGAAAAGATGTGATGAGAG
                      ____________________________________________________________
consensus AGCACTGCCCAACTCCATTGTAGAAGTGGAAGGATCGGAGGAGAAAAGATGTGATGAGAG
 
. : . : . : . : . : . :
JMFF042I07+ GAGAGAAAGGGAAGTATAAATAGCTGAAGATTTTGAAGCTGCGCTGATAGAGTAAATAAT
                      ____________________________________________________________
consensus GAGAGAAAGGGAAGTATAAATAGCTGAAGATTTTGAAGCTGCGCTGATAGAGTAAATAAT