Previous Contig 001807:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003G19Sequence471001807 (126)gb:AY085669_15707365e-62Arabidopsis thaliana clone 16846 mRNA, complete sequence.719001807 (126)gb:AY224189_15906211e-71Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF004J20Sequence348001807 (126)gb:AY085669_15707363e-41Arabidopsis thaliana clone 16846 mRNA, complete sequence.741001807 (126)gb:AY224189_15906216e-69Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF004L06Sequence567001807 (126)sp|P50248|SAHH_TOBAC2e-79Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc706001807 (126)gb:AY224189_15906211e-80Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF005A22Sequence534001807 (126)gb:AY085669_15707363e-54Arabidopsis thaliana clone 16846 mRNA, complete sequence.755001807 (126)gb:AY224189_15906214e-72Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF008E18Sequence534001807 (126)gb:AY085669_15707366e-74Arabidopsis thaliana clone 16846 mRNA, complete sequence.755001807 (126)gb:AY224189_15906212e-73Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF009I05Sequence587014231gb:AY224544_15907412e-69Oryza sativa (japonica cultivar-group) isolate 23829 wheat adenosylhomocysteinas729001807 (126)gb:AY224189_15906212e-64Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF010H21Sequence458001807 (126)gb:AY085669_15707362e-53Arabidopsis thaliana clone 16846 mRNA, complete sequence.759001807 (126)gb:AY224189_15906212e-68Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF010I01Sequence533001807 (126)gb:AY085669_15707366e-74Arabidopsis thaliana clone 16846 mRNA, complete sequence.498001807 (126)gb:TOBCBP57B_17253763e-25Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF010J16Sequence535001807 (126)gb:AY085669_15707361e-74Arabidopsis thaliana clone 16846 mRNA, complete sequence.
JMFF011N09Sequence529001807 (126)gb:AY224189_15906217e-81Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.678001807 (126)gb:AY224189_15906211e-57Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF014D10Sequence504001807 (126)sp|P50248|SAHH_TOBAC4e-73Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc739001807 (126)sp|P50246|SAHH_MEDSA1e-73Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFF016N16Sequence567001807 (126)sp|P50248|SAHH_TOBAC8e-79Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc121021033
JMFF018A02Sequence534001807 (126)gb:AY085669_15707363e-68Arabidopsis thaliana clone 16846 mRNA, complete sequence.669001807 (126)gb:AY224189_15906219e-75Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF019J06Sequence525001807 (126)gb:AY085669_15707363e-72Arabidopsis thaliana clone 16846 mRNA, complete sequence.752001807 (126)gb:AY224189_15906212e-73Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF019N20Sequence533001807 (126)gb:AY085669_15707369e-60Arabidopsis thaliana clone 16846 mRNA, complete sequence.729001807 (126)gb:AY224189_15906216e-63Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF020I03Sequence170001807 (126)147001807 (126)
JMFF021B15Sequence437001807 (126)gb:AY085669_15707369e-48Arabidopsis thaliana clone 16846 mRNA, complete sequence.740001807 (126)gb:AY224189_15906211e-69Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF021H20Sequence490001807 (126)gb:AY085669_15707366e-67Arabidopsis thaliana clone 16846 mRNA, complete sequence.741001807 (126)gb:AY224189_15906218e-71Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF022C17Sequence495001807 (126)gb:AY085669_15707366e-67Arabidopsis thaliana clone 16846 mRNA, complete sequence.704001807 (126)gb:AY224189_15906211e-72Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF022M12Sequence192001807 (126)gb:AY085669_15707362e-11Arabidopsis thaliana clone 16846 mRNA, complete sequence.755001807 (126)gb:AY224189_15906212e-73Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF024E14Sequence442001807 (126)gb:AY085669_15707362e-54Arabidopsis thaliana clone 16846 mRNA, complete sequence.696001807 (126)gb:AY224189_15906217e-63Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF024O02Sequence465001807 (126)gb:AY085669_15707361e-60Arabidopsis thaliana clone 16846 mRNA, complete sequence.728001807 (126)gb:AY224189_15906216e-68Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF025A07Sequence436001807 (126)gb:AY085669_15707364e-52Arabidopsis thaliana clone 16846 mRNA, complete sequence.519010704 (3)gb:AY075677_15678167e-05Arabidopsis thaliana AT5g58470/mqj2_60 mRNA, complete cds.>gb:AF367294_1791746 A
JMFF030J03Sequence484001807 (126)gb:AY085669_15707361e-58Arabidopsis thaliana clone 16846 mRNA, complete sequence.
JMFF031D18Sequence742001807 (126)gb:AY224189_15906214e-74Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF031J12Sequence536001807 (126)gb:AY085669_15707363e-68Arabidopsis thaliana clone 16846 mRNA, complete sequence.755001807 (126)gb:AY224189_15906212e-73Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF032D22Sequence494001807 (126)gb:AY085669_15707366e-67Arabidopsis thaliana clone 16846 mRNA, complete sequence.177001807 (126)
JMFF032D23Sequence561001807 (126)sp|P50248|SAHH_TOBAC1e-78Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc744001807 (126)gb:TOBCBP57B_17253763e-71Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF034K14Sequence492001807 (126)gb:AY085669_15707366e-67Arabidopsis thaliana clone 16846 mRNA, complete sequence.735001807 (126)gb:AY224189_15906212e-71Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF035B06Sequence494001807 (126)gb:AY085669_15707361e-67Arabidopsis thaliana clone 16846 mRNA, complete sequence.731001807 (126)gb:AY224189_15906211e-69Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF036B05Sequence495001807 (126)gb:AY085669_15707366e-67Arabidopsis thaliana clone 16846 mRNA, complete sequence.745001807 (126)gb:AY224189_15906212e-71Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF038B22Sequence436001807 (126)gb:AY085669_15707362e-53Arabidopsis thaliana clone 16846 mRNA, complete sequence.688001807 (126)gb:AY224189_15906211e-60Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFF042F17Sequence617001807 (126)sp|P50248|SAHH_TOBAC8e-88Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFF042F24Sequence621001807 (126)sp|P50248|SAHH_TOBAC3e-89Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc593001807 (126)gb:TOBCBP57B_17253762e-38Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF043F01Sequence611001807 (126)sp|P50248|SAHH_TOBAC4e-72Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc601001807 (126)gb:TOBCBP57B_17253768e-42Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF044E10Sequence641001807 (126)sp|P35007|SAHH_CATROe-106Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc425001807 (126)gb:TOBCBP57B_17253764e-28Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF044G18Sequence431001807 (126)gb:AY224544_15907412e-72Oryza sativa (japonica cultivar-group) isolate 23829 wheat adenosylhomocysteinas431001807 (126)gb:AY224544_15907412e-72Oryza sativa (japonica cultivar-group) isolate 23829 wheat adenosylhomocysteinas
JMFF044O13Sequence664001245 (85)gb:AY550990_1613318e-106Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.625001807 (126)gb:TOBCBP57B_17253762e-38Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF045A03Sequence580001807 (126)sp|P50248|SAHH_TOBAC5e-81Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc589001807 (126)gb:TOBCBP57B_17253764e-40Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF046A02Sequence570001807 (126)sp|P50248|SAHH_TOBAC2e-79Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc597001807 (126)gb:TOBCBP57B_17253768e-35Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF047B14Sequence576001807 (126)sp|P50248|SAHH_TOBAC7e-82Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc530010704 (3)gb:AY086517_15715654e-04Arabidopsis thaliana clone 25545 mRNA, complete sequence.
JMFF047K05Sequence443001807 (126)gb:AY085669_15707361e-61Arabidopsis thaliana clone 16846 mRNA, complete sequence.
JMFF047O17Sequence513001807 (126)gb:AY085669_15707368e-70Arabidopsis thaliana clone 16846 mRNA, complete sequence.454001807 (126)gb:A57643_14498185e-06Sequence 1 from Patent WO9632488.
JMFF048P03Sequence261001807 (126)gb:AY085669_15707367e-28Arabidopsis thaliana clone 16846 mRNA, complete sequence.418001807 (126)
JMFF049M24Sequence623001807 (126)sp|P50248|SAHH_TOBAC1e-88Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc643001807 (126)gb:TOBCBP57B_17253766e-41Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF050C13Sequence594001807 (126)sp|P50248|SAHH_TOBAC8e-85Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc254001807 (126)
JMFF050M20Sequence573001807 (126)sp|P50248|SAHH_TOBAC6e-82Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc362001807 (126)gb:A57643_14498184e-06Sequence 1 from Patent WO9632488.
JMFF050P08Sequence610001807 (126)sp|P50248|SAHH_TOBAC2e-87Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFF051L19Sequence524001807 (126)gb:AY085669_15707362e-71Arabidopsis thaliana clone 16846 mRNA, complete sequence.474001807 (126)gb:TOBCBP57B_17253766e-18Tobacco mRNA for cytokinin binding protein CBP57, complete cds.
JMFF051O15Sequence568001807 (126)sp|P50248|SAHH_TOBAC6e-78Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc492001807 (126)gb:A57643_14498189e-15Sequence 1 from Patent WO9632488.
JMFN009I15Sequence619001807 (126)gb:AY224189_15906213e-95Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFN009N16Sequence631001807 (126)sp|P35007|SAHH_CATROe-100Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFN013J09Sequence627001807 (126)gb:A57643_14498188e-54Sequence 1 from Patent WO9632488.
JMFN018F01Sequence595001807 (126)sp|P50248|SAHH_TOBAC2e-89Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFN018G06Sequence557001807 (126)sp|P50248|SAHH_TOBAC4e-86Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFN029O01Sequence552001807 (126)gb:AY224189_15906213e-66Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMFN038J21Sequence593001807 (126)gb:AF212157_1777422e-100Allium cepa S-adenosylhomocysteine hydrolase mRNA, partial cds.
JMFS040C03Sequence502001807 (126)sp|P50248|SAHH_TOBAC4e-83Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFS052H08Sequence604001807 (126)gb:AF212157_17774222e-93Allium cepa S-adenosylhomocysteine hydrolase mRNA, partial cds.
JMFS054E10Sequence617001807 (126)sp|P32112|SAHH_WHEATe-112Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc
JMFS075F05Sequence155001807 (126)
JMFS088F02Sequence615001807 (126)gb:AF212157_17774221e-94Allium cepa S-adenosylhomocysteine hydrolase mRNA, partial cds.
JMFS133H06Sequence624001807 (126)gb:AF212157_17774222e-93Allium cepa S-adenosylhomocysteine hydrolase mRNA, partial cds.
JMSF001N13Sequence401001807 (126)gb:AY085669_15707369e-45Arabidopsis thaliana clone 16846 mRNA, complete sequence.642001807 (126)gb:AY224189_15906213e-56Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMSF002C24Sequence419001807 (126)gb:AY224544_15907413e-70Oryza sativa (japonica cultivar-group) isolate 23829 wheat adenosylhomocysteinas703012723 (3)gb:AP001313_18211745e-51Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:T5M7.
JMSF004A11Sequence247001807 (126)gb:A57643_14498183e-29Sequence 1 from Patent WO9632488.
JMSF004C13Sequence348001807 (126)gb:AY085669_15707361e-42Arabidopsis thaliana clone 16846 mRNA, complete sequence.
JMSF004O13Sequence240003177 (4)319001807 (126)gb:A57643_14498182e-10Sequence 1 from Patent WO9632488.
JMSF012M07Sequence454001807 (126)gb:AY085669_15707367e-58Arabidopsis thaliana clone 16846 mRNA, complete sequence.
JMSF014I15Sequence497001807 (126)gb:AY085669_15707363e-66Arabidopsis thaliana clone 16846 mRNA, complete sequence.770001807 (126)gb:AY224189_15906211e-81Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMSF018A12Sequence522001807 (126)gb:AY085669_15707362e-72Arabidopsis thaliana clone 16846 mRNA, complete sequence.773001807 (126)gb:AY224189_15906215e-82Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMSF018J09Sequence541001807 (126)gb:AY085669_15707366e-75Arabidopsis thaliana clone 16846 mRNA, complete sequence.471007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF018K13Sequence226001807 (126)gb:AY224544_15907412e-17Oryza sativa (japonica cultivar-group) isolate 23829 wheat adenosylhomocysteinas
JMSF023H12Sequence375001807 (126)gb:AY085669_15707369e-45Arabidopsis thaliana clone 16846 mRNA, complete sequence.559001807 (126)gb:AY224189_15906212e-56Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMSF032A20Sequence669001807 (126)sp|P35007|SAHH_CATRO7e-97Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc712001807 (126)gb:AY224189_15906217e-71Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMSF039O11Sequence645001807 (126)gb:AF212157_17774222e-93Allium cepa S-adenosylhomocysteine hydrolase mRNA, partial cds.810001807 (126)gb:AY224189_15906216e-88Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMSF046M04Sequence690001807 (126)gb:AY224189_15906211e-80Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.655024225pir|D85439|D854393e-35tubulin-like protein [imported] - Arabidopsis thaliana>gb:ATAP21_1543978 Arabido
JMSF048E24Sequence623001807 (126)sp|P50248|SAHH_TOBAC5e-90Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc721001807 (126)gb:AY224189_15906212e-73Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds.
JMSF052P08Sequence627001807 (126)gb:AF212157_17774224e-90Allium cepa S-adenosylhomocysteine hydrolase mRNA, partial cds.874001807 (126)gb:AY224544_15907417e-98Oryza sativa (japonica cultivar-group) isolate 23829 wheat adenosylhomocysteinas

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047O17- CCTTATGGCGGATCAC
rJMFF046A02- CCTTATGGCGGATCAC
                      ____________________________________________________________
consensus CCTTATGGCGGATCAC
 
. : . : . : . : . : . :
rJMFF047O17- CCTGGAGAGTTTTTTTTTTTTTTTTGAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF046A02- CCTGGAGAGTTTTTTTTTTTTTTTTGAAAAGC-AATTTGGTTTCCATTTTTTAATGAAAG
rJMFF045A03- GAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF051L19- GAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF048P03- AAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF050M20- GAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF042F24- GAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF051O15- GAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF050C13- GAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
JMFF020I03+ TTTTTTTTTNGAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
JMFS075F05+ GAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF044O13- TTTTTTTTTTTTTTTTGAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF049M24- AATTTGGTTTCCATTTTTTAATGAAAG
rJMFF043F01- AAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
rJMFF011N09- ATTTGGTTTCNATTTTTTAATGAAAG
rJMFF009I05- TTGGTTTCNATTTTTTAATGAAAG
rJMFF005A22- TTTGGTTTCNATTTTTTAATGAAAG
rJMFF024O02- TTGGTTTCNTTTTTTA-ATGAAAG
rJMFF004J20- TTGGTTTCATTTTTTA-ATGAAAG
rJMFF024E14- TTGGTTTCNATTTTTT-ATGAAAG
rJMFF038B22- TTGGTTTCNTTTTTTA-ATGAAAG
rJMFF010H21- TTGGTTTCNTTTTTTA-ATGAAAG
rJMFF019N20- GGTTTC-ATTTTTT-ATGAAAG
rJMFF019J06- TGGTTTC-ATTTTTT-ATGAAAG
rJMFF036B05- TTGGTTTC-NTTTTTT-ATGAAAG
rJMFF032D23- TTGGTTTC-NTTTTTT-ATGAAAG
rJMFF031J12- TTGGTTTC-NTTTTTT-ATGAAAG
rJMFF022M12- TTGGTTTC-NTTTTTT-ATGAAAG
rJMFF021H20- TTGGTTTC-NTTTTTT-ATGAAAG
rJMFF034K14- TTTTTT-ATGAAAG
rJMFF021B15- TTGGTTTC-NTTTTTT-ATGAAAG
rJMFF035B06- TTTTTT-ATGAAAG
rJMFF020I03- TTGGTTTC-NTTTTTT-ATGAAAG
rJMFF008E18- TGGTTTCNATTTTTT-ATGAAAG
rJMFF031D18- TGAAAG
                      ____________________________________________________________
consensus CCTGGAGAGTTTTTTTTTTTTTTTTGAAAAGCAAATTTGGTTTCCATTTTTTAATGAAAG
 
. : . : . : . : . : . :
rJMFF047O17- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF046A02- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF045A03- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF051L19- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF048P03- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF050M20- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF042F24- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF051O15- AACAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF050C13- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGGTACAATACCACACACCTCC
JMFF020I03+ AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
JMFS075F05+ AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF044O13- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF049M24- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF043F01- AAAAGCCATAACAGATGCAAACCAATCTAAAAGAAACAGGCTACAATACCACACACCTCC
rJMFF011N09- AAAAGCCATAAAAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF009I05- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF032D22- AAAGCCATAACAGATGCANNCCAATCTANCAGAAACAGGCTACAATACCACACACCTCC
rJMFF005A22- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF024O02- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF004J20- AAAAGCCATAACAGATGCAAACCAATCTAAAAGAAACAGGCTACAATACCACACACCTCC
rJMFF024E14- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF038B22- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF010H21- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF019N20- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF019J06- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF036B05- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF032D23- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF031J12- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF022M12- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF021H20- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF034K14- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF021B15- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF035B06- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMSF048E24- ACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMSF032A20- TAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF010I01- ACCAATCTAACAGAAACTGGCTACAATACCGCACACCTCC
JMFN013J09+ GCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMSF001N13- ACAGATGCNAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF003G19- AGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF020I03- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF008E18- AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMFF031D18- AAAAGCCATAACAGATGCAAACCAATCTAAAAGAAACAGGCTACAATACCACACACCTCC
rJMSF014I15- TAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMSF018A12- ACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMSF039O11- GCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
rJMSF052P08- GCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
                      ____________________________________________________________
consensus AAAAGCCATAACAGATGCAAACCAATCTAACAGAAACAGGCTACAATACCACACACCTCC
 
. : . : . : . : . : . :
rJMFF047O17- NACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF046A02- NACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF045A03- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF051L19- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCGTCCTTTCAA
rJMFF048P03- AACCACACAACCTTATTCAACATATAAGGGGGCCTTTTACAAAAAAGACCATCCTTTCCA
rJMFF050M20- AACCACACAACCTTATTCAACATATAAGGGGGTCTTTTACAAAAAAGACCATCCTTTCAA
rJMFF042F24- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF051O15- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF050C13- AACCACACAACCTTATTCAACATATAAGGGGGGCTTTTACAAAAAAGACCATCCTTTCAA
JMFF020I03+ AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
JMFS075F05+ AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCA
rJMFF044O13- NACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF049M24- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF043F01- NACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF011N09- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF009I05- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF032D22- NACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF005A22- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF024O02- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF004J20- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF024E14- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF038B22- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF010H21- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF019N20- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF019J06- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF036B05- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF032D23- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF031J12- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF022M12- AACCACACAACATTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF021H20- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF034K14- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF021B15- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF035B06- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF048E24- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF032A20- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF010I01- NACCACACAACCTTATTCAACATATAANGTGGTCTTTTACGAGAAANACCATCCTTTCAA
rJMFF044E10- GGTCTTTTACAAGAAAGACCATCCTTTCAA
JMFN013J09+ AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF001N13- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF003G19- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF020I03- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF008E18- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF031D18- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF018A02- CAACCTTATTC-ACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMFF022C17- ACCTTATTC-ACATATAAGGTGGTCTTTTACNNGAAAGACCATCCTTTCAA
rJMFF004L06- ACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF014I15- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF018A12- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF023H12- CTTTTACAAGAAAGACCATCCTTTCNA
JMSF046M04- GGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF039O11- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
rJMSF052P08- AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
                      ____________________________________________________________
consensus AACCACACAACCTTATTCAACATATAAGGTGGTCTTTTACAAGAAAGACCATCCTTTCAA
 
. : . : . : . : . : . :
rJMFF047O17- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF046A02- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF045A03- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF051L19- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTCACAGTGCAAATCAA
rJMFF048P03- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAC
rJMFF050M20- ATATTCCA-GCCTCCCATAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF042F24- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF051O15- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF050C13- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
JMFF020I03+ ATATT
rJMFF044O13- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF049M24- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF043F01- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF011N09- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF009I05- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF032D22- ATATTCCA-GNCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TANTGCAAATCAA
rJMFF005A22- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF024O02- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF004J20- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF024E14- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF038B22- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF010H21- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF019N20- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF019J06- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF036B05- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF032D23- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF031J12- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF022M12- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF021H20- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF034K14- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF021B15- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF035B06- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMSF048E24- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMSF032A20- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF010I01- ATATTCCA-GCCTCCCNAAATCCATCAACCAAAAACTACCTGTCTC-TANTGCANATCAA
rJMFF044E10- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
JMFN013J09+ ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMSF001N13- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAN
rJMFF003G19- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF020I03- ATATT
rJMFF008E18- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF031D18- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF018A02- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF022C17- ATATTCCATGCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMFF004L06- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMSF014I15- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMSF018A12- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
JMFN029O01+ GCAAATCAA
rJMSF023H12- ATATTCCACGCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
JMSF046M04- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMSF039O11- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
rJMSF052P08- ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
                      ____________________________________________________________
consensus ATATTCCA-GCCTCCCAAAATCCATCAACCAAAAACTACCTGTCTC-TAGTGCAAATCAA
 
. : . : . : . : . : . :
rJMFF047O17- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF046A02- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF045A03- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF051L19- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF048P03- AATGTGTATAAAGAAGGCAACAATCCCATTAAAAAACATTCTCTTCTTGAACTTCCAAGC
rJMFF050M20- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF042F24- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF051O15- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF050C13- AATGGGTATAAAGAAGGCAACAATCGCATTAAAACACATTC
rJMFF044O13- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF049M24- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF043F01- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF011N09- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF009I05- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF005A22- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF024O02- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF004J20- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF024E14- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF038B22- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF010H21- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF019N20- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF019J06- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF036B05- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF032D23- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF031J12- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF022M12- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF021H20- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF034K14- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF021B15- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF035B06- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMSF048E24- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMSF032A20- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF010I01- AATGTGTATAAAGAAGGCAACAATCNCATTAAAACACATTCTCTTCTTGATCTTCTAGGC
rJMFF044E10- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
JMFN013J09+ AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMSF001N13- AATGTGTATAAAGAAGGCAACAATCGCATTANAACACATCCTCTTCTTGATCTTCGAGGC
rJMFF003G19- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF008E18- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF031D18- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF018A02- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF022C17- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMFF004L06- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMSF014I15- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMSF018A12- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
JMFN029O01+ AATGTG-ATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMSF023H12- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
JMSF046M04- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
rJMSF039O11- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
JMFN009I15+ TCGAGGC
rJMSF052P08- AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
                      ____________________________________________________________
consensus AATGTGTATAAAGAAGGCAACAATCGCATTAAAACACATTCTCTTCTTGATCTTCGAGGC
 
. : . : . : . : . : . :
rJMFF047O17- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF046A02- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF045A03- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF051L19- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF048P03- TTCCTTCCGCTTAATACCTGTAATGAAGAAGCTTGTAAAGACCCTCCACTGGAAAACTAA
rJMFF050M20- TTCCTTCCGCTTAATACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF042F24- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF051O15- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF044O13- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF049M24- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF043F01- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF011N09- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF009I05- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF005A22- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF024O02- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF004J20- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF024E14- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF038B22- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF010H21- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF019N20- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF019J06- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF036B05- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF032D23- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF031J12- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF022M12- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF021H20- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF034K14- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF021B15- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF035B06- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF048E24- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF032A20- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF010I01- TTCCTTCCGCTTATNACCTGTATTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF044E10- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
JMFN013J09+ TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF001N13- TTCCTTCCGCTTANTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF003G19- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF014D10- TTAATACCTGTAGTTCGGAGGCTTGTAAGGACCCTCAACTGGAACACTAA
rJMSF004O13- TTAGTACCTGTAGTTCGGAGGCTTGTAAGGACCCTCAACTGGAACACTAA
rJMFF008E18- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF031D18- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF018A02- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF022C17- TTCCTTCCGCTTATTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMFF004L06- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF014I15- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF018A12- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
JMFN029O01+ TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF023H12- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
JMFF011N09+ CTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
JMSF046M04- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF039O11- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
JMFN009I15+ TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
rJMSF052P08- TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
                      ____________________________________________________________
consensus TTCCTTCCGCTTAGTACCTGTAGTGAGGAGGCTTGTAAGGACCCTCAACTGGAATACTAA
 
. : . : . : . : . : . :
rJMFF047O17- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF046A02- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF045A03- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF051L19- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF048P03- TG
rJMFF050M20- TGTAAGCAGCTTGTTCGGGGGTAAGTTTA
rJMFF042F24- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF051O15- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF044O13- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF049M24- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF043F01- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF011N09- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF009I05- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF005A22- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF024O02- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF004J20- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF024E14- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF038B22- TGTAAGCAACTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF010H21- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF019N20- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF019J06- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF036B05- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF032D23- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF031J12- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF022M12- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF021H20- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF034K14- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF021B15- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF035B06- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF048E24- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF032A20- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF010I01- TGNAAGCANCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF044E10- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
JMFN013J09+ TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF001N13- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF003G19- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF014D10- TGTAAGCAGCTTGGTCAGGGCTAAGTTTAGTGAGCTTGGCACCCAGCTTCCCAATATGAA
rJMSF004O13- TGTAAGCAGCTTGGTCAGGGCTAAGTTTAGTGAGCTTGGCACCCAGCTTCCC
rJMFF008E18- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF031D18- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF018A02- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF022C17- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMFF004L06- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF014I15- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF018A12- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
JMFN029O01+ TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF023H12- TGTAAGCAGCTTGTTCGGGGGTAAGTTTANTGAGCTTGGCACCGAGCTTCCCGAGATGAA
JMFF011N09+ TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
JMSF046M04- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF039O11- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
JMFN009I15+ TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
rJMSF052P08- TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
                      ____________________________________________________________
consensus TGTAAGCAGCTTGTTCGGGGGTAAGTTTAGTGAGCTTGGCACCGAGCTTCCCGAGATGAA
 
. : . : . : . : . : . :
rJMFF047O17- GGGCAGCAACCTTCTCATCG
rJMFF046A02- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF045A03- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF051L19- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF042F24- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF051O15- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF044O13- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF049M24- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF043F01- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF011N09- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF009I05- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF005A22- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF024O02- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF004J20- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF024E14- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF038B22- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF010H21- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF019N20- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF019J06- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF036B05- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF032D23- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF031J12- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF022M12- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF021H20- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF034K14- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF021B15- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF035B06- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF048E24- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF032A20- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF010I01- NGGCANCAACCTTCTCATCNANGTGCTTTGGCAAGACNTAAACCTTCNTCT---CNNACT
rJMFF044E10- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
JMFN013J09+ GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF001N13- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF003G19- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF014D10- GGGCAGCAACCTTCTCATCCAGGTGCTTTGGCAACACGTAAACCTTCTTCTCATCGTACT
rJMFF008E18- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF031D18- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF018A02- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF022C17- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMFF004L06- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF014I15- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF018A12- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
JMFN029O01+ GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF023H12- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
JMFF011N09+ GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
JMSF046M04- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF039O11- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
JMFN009I15+ GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
rJMSF052P08- GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
                      ____________________________________________________________
consensus GGGCAGCAACCTTCTCATCGAGGTGCTTTGGCAAGACGTAAACCTTCTTCT---CGTACT
 
. : . : . : . : . : . :
rJMFF046A02- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF045A03- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF051L19- TGCCGGTGTTCTTCTCCTTCCAC
rJMFF042F24- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF051O15- TGCCG
rJMFF044O13- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF049M24- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF043F01- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF011N09- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF009I05- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF005A22- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF024O02- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF004J20- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF024E14- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF038B22- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF010H21- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF019N20- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF019J06- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF036B05- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF032D23- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF031J12- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF022M12- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF021H20- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF034K14- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF021B15- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF035B06- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF048E24- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF032A20- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF010I01- TGCCGGTGTNCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGNTGAATGAGC
rJMFF044E10- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGG
JMFN013J09+ TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF001N13- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF003G19- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF014D10- TCCCACTGCTCTTCTCCTTCCACAGCTCCAGCTGGGCAATCACTTGGTTGGTGAAGGAGC
rJMFF008E18- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF031D18- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF018A02- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF022C17- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMFF004L06- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF014I15- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF018A12- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
JMFN029O01+ TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF023H12- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
JMFF011N09+ TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
JMSF046M04- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF039O11- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
JMFN009I15+ TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
rJMSF052P08- TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
JMFS054E10+ GGGCGATGACTTGGTTGGTGAATGAGC
                      ____________________________________________________________
consensus TGCCGGTGTTCTTCTCCTTCCACAGCTCAAGCTGGGCGATGACTTGGTTGGTGAATGAGC
 
. : . : . : . : . : . :
rJMFF046A02- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATG
rJMFF045A03- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF042F24- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF044O13- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF049M24- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF043F01- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF011N09- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF009I05- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF005A22- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF024O02- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF004J20- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF024E14- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF038B22- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF010H21- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF019N20- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF019J06- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF036B05- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF032D23- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF031J12- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF022M12- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF021H20- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF034K14- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF021B15- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF035B06- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF048E24- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF032A20- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF010I01- AGGACATCACGAAACTGGNGTGTNCGGTGGNGCAACCCAAGTT
JMFN013J09+ AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF001N13- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF003G19- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF014D10- AAGACATCACGAAACTAGGATGTCTGGAGCCACAACCCAAGTTCATAAGACGCCCCTCGC
rJMFF008E18- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF031D18- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF018A02- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF022C17- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMFF004L06- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF014I15- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF018A12- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
JMFN029O01+ AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF023H12- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
JMFF011N09+ AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
JMSF046M04- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF039O11- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
JMFN009I15+ AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
rJMSF052P08- AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
JMFS054E10+ AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
                      ____________________________________________________________
consensus AGGACATCACGAAACTGGGGTGTCCGGTGGCGCAACCCAAGTTCATGAGACGGCCCTCGG
 
. : . : . : . : . : . :
rJMFF045A03- CCAGAATAATGATGCCAG
rJMFF042F24- CCAGAAT-ATGATGCCAGTCTTG
rJMFF044O13- CCAGAAT-ATGATGCCAGTCTTGGTCTCG
rJMFF049M24- CCAGAATAATGATGCCAGTCTTGGTCTC
rJMFF043F01- CCAGAATAATGATGCCAGTCTTGGTCTCGGG
rJMFF011N09- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF009I05- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF005A22- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF024O02- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF004J20- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF024E14- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF038B22- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF010H21- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF019N20- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF019J06- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF036B05- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF032D23- CCAGAATAATGATGCCAGTCTTGGTATCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF031J12- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF022M12- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF021H20- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF034K14- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF021B15- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF035B06- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF048E24- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF032A20- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
JMFN013J09+ CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF001N13- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF003G19- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF014D10- CCAAAACAATGATGCCATTCTTGGTATCCGGGAACACAAATCTGTCGGTCTGAGGTTTGA
rJMFF008E18- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF031D18- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF018A02- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF022C17- CCAGAATAATGATGCCANTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMFF004L06- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF014I15- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF018A12- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
JMFN029O01+ CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF023H12- CCANAATAATGATGCCAGTCTTGGTCTCNGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
JMFF011N09+ CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
JMSF046M04- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF039O11- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
JMFN009I15+ CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
rJMSF052P08- CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
JMFS054E10+ CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
                      ____________________________________________________________
consensus CCAGAATAATGATGCCAGTCTTGGTCTCGGGGAAGACGAATCTGTCAGTCTGAGGCTTGA
 
. : . : . : . : . : . :
rJMFF011N09- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGT
rJMFF009I05- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF005A22- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF024O02- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF004J20- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF024E14- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF038B22- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF010H21- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF019N20- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF019J06- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF036B05- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF032D23- TGGTGATTCTTTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF031J12- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF022M12- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF021H20- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF034K14- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF021B15- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF035B06- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMSF048E24- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMSF032A20- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
JMFN013J09+ TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCC
rJMSF001N13- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCNTGTCGATTTCATTGT
rJMFF003G19- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF014D10- TGGTGGTTCTCTTTACACCAGGGTATGTCTCAAGCCCGTGCATGTCAATTTCATTGTCGA
rJMFF008E18- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF031D18- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF018A02- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF022C17- TGGTGATTCTCTTCACGCCANGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMFF004L06- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMSF014I15- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMSF018A12- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
JMFN029O01+ TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMSF023H12- TGGTGATTCTCTTCACGCCAGGGNACGTCTCGAGCCCGTGCATGTCGATTTCATTG
JMFF011N09+ TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
JMSF046M04- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMSF039O11- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
JMFN009I15+ TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
rJMSF052P08- TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
JMFS054E10+ TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
                      ____________________________________________________________
consensus TGGTGATTCTCTTCACGCCAGGGTACGTCTCGAGCCCGTGCATGTCGATTTCATTGTCGA
 
. : . : . : . : . : . :
rJMFF009I05- AGTGGCCAATGTTGC-AAACAATGGCCGTTGTTCTT-CATCTTCTTCATGTG
rJMFF005A22- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF024O02- AGTGGCCAATGTTGC-AAACNATGG-CGTTGTTCTT-CATCTTCTTCATGTGG
rJMFF004J20- AGTGGCCAATGTTGC-AAACNATGG-CGTTGNTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF024E14- AGTGGCCAATGTTGC-AAA
rJMFF038B22- AGTGGCCAAT
rJMFF010H21- AGTGGCCAATGTTGCAAAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF019N20- AGTGGCCAATGTTGCAAAACAATGG-CGTTGGTCTT-CATCTTCTTCATGTGG
rJMFF019J06- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF036B05- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGNGGCTAA-CC
rJMFF032D23- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF031J12- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF022M12- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF021H20- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF034K14- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF021B15- AGTGGCCAATGTTGC-AAACAATGG-CGTTGNTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF035B06- AGTGGCCAATGTTGC-AAACAATGG-CGTTGNTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMSF048E24- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMSF032A20- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF003G19- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF014D10- AGTGCCCAATGTTGC-AAACAATGG-CGTTGTTCTTCCATCTTCTTCATGTGGCTAA-CC
rJMFF008E18- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF031D18- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF018A02- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMFF022C17- AGTGGCCAATGTTGC-AAACAATGG-CGTTGNTCTT-CATCTTCTTCATGTGGCTAACCC
rJMFF004L06- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMSF014I15- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMSF018A12- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
JMFN029O01+ AGTGGCCAATG-TGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
JMFF011N09+ AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
JMSF046M04- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMSF039O11- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
JMFN009I15+ AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
rJMSF052P08- AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
JMFS054E10+ AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
                      ____________________________________________________________
consensus AGTGGCCAATGTTGC-AAACAATGG-CGTTGTTCTT-CATCTTCTTCATGTGGCTAA-CC
 
. : . : . : . : . : . :
rJMFF005A22- ATGATGATGTCCTTG
rJMFF004J20- ATGATGA
rJMFF010H21- ATGATGATGTCCTTGTTGCCCG
rJMFF019J06- ATGATGATGTCCTTGTTGCC
rJMFF036B05- ATGATGATGTCC
rJMFF032D23- ATGATGATGTC
rJMFF031J12- ATGATGATGTCCTTGTTGCCCG
rJMFF022M12- ATGATGATGTCCTTGTTGCCCG
rJMFF021H20- ATGATGAT
rJMFF034K14- ATGATGATGTC
rJMFF021B15- ATGATGA
rJMFF035B06- ATGATGA
rJMSF048E24- ATGATGATGTCCTTGTTGCC
rJMSF032A20- ATGATGATG
rJMFF003G19- ATGATGATGTC
rJMFF014D10- ATGATGACGTCCTTGTTGCC
rJMFF008E18- ATGATGATGTCCTTGTTGCCCG
rJMFF031D18- ATGATGATGTCCTTGTTGCCCGTGG
rJMFF018A02- ATGATGATGTCCTTGTTGCCCGTGGT
rJMFF022C17- ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
rJMFF004L06- ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
rJMSF014I15- ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
rJMSF018A12- ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACANCATCC
JMFN029O01+ ATGATGATGTCC
JMFF011N09+ ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATC
JMSF046M04- ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
rJMSF039O11- ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
JMFN009I15+ ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
rJMSF052P08- ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
JMFS054E10+ ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
                      ____________________________________________________________
consensus ATGATGATGTCCTTGTTGCCCGTGGTGGTGACAAAGATATCGGCTTCCGAGACAACATCC
 
. : . : . : . : . : . :
rJMFF022C17- T
rJMFF004L06- T
rJMSF014I15- TCGAGGG
rJMSF018A12- TCGAGGGTAAGA
JMSF046M04- T
rJMSF039O11- TCGAGGGTAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAG
JMFN009I15+ TCGAGGGTAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAGCACAGATTGGATCAATC
rJMSF052P08- TCGAGGGTAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAGCACAGATTGGATCAATC
JMFS054E10+ TCGAGGGTAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAGCACAGATTGGATCAATC
rJMFF044G18+ GGTAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAGCACAGATTGGATCAATC
JMSF002C24- TAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAGCACAGATTGGATCAATC
JMFF044G18- GGTAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAGCACAGATTGGATCAATC
JMFF044E10+ CAGATTGGATCAATC
                      ____________________________________________________________
consensus TCGAGGGTAAGAACTTGGAGACCCTCCATGAGGGCCTGGAGAGCACAGATTGGATCAATC
 
. : . : . : . : . : . :
JMFN009I15+ TCAGTCACAATCACACGAG
rJMSF052P08- TCAGTCACAATCACACGAGCACCAGCCTGCTTC-AAGCTGCAGCACAG
JMFS054E10+ TCAGTCACAATCACACGAGCACCAGCCTGCTTCAAAGCTGCAGCACAGCCCTTGCCAACA
rJMFF044G18+ TCAGTCACAATCACACGAGCACCAGCCTGCTTCAAAGCTGCAGCACAGCCCTTGCCAACA
JMSF002C24- TCAGTCACAATCACACGAGCACCAGCCTGCTTCAAAGCTGCAGCACAGCCCTTGCCAACA
JMFF044G18- TCAGTCACAATCACACGAGCACCAGCCTGCTTCAAAGCTGCAGCACAGCCCTTGCCAACA
JMFF044E10+ TCAGTCACAATCACACGAGCACCAGCCTGCTTCAAAGCTGCAGCACAGCCCTTGCCAACA
                      ____________________________________________________________
consensus TCAGTCACAATCACACGAGCACCAGCCTGCTTCAAAGCTGCAGCACAGCCCTTGCCAACA
 
. : . : . : . : . : . :
JMFS054E10+ TCTCCGTAACCACACACAACTGCCACCTTTCCGGCAATCATCACATCAGTGGCTCTCATC
rJMFF044G18+ TCTCCGTAACCACACACAACTGCCACCTTTCCGGCAATCATCACATCAGTGGCTCTCATC
JMSF002C24- TCTCCGTAACCACACACAACTGCCACCTTTCCGGCAATCATCACATCAGTGGCTCTCATC
JMFF044G18- TCTCCGTAACCACACACAACTGCCACCTTTCCGGCAATCATCACATCAGTGGCTCTCATC
JMFF044E10+ TCTCCGTAACCACACACAACTGCCACCTNTCCGGCAATCATCACATCAGTGGCTCTCATC
JMFN038J21+ CTTTCCGGCAATCATCACATCAGTGGCTCTCATC
                      ____________________________________________________________
consensus TCTCCGTAACCACACACAACTGCCACCTTTCCGGCAATCATCACATCAGTGGCTCTCATC
 
. : . : . : . : . : . :
JMFS054E10+ AAACCATCGGGAAGAGAGTGGCGGCATCCATACAAGTTGTCAAACTTGCTCTTGGTTACA
rJMFF044G18+ AAACCATCGGGAAGAGAGTGGCGGCATCCATACAAGTTGTCAAACTTGCTCTTGGTTACA
JMSF002C24- AAACCATCGGGAAGAGAGTGGCGGCATCCATACAAGTTGTCAAACTTGCTCTTGGTTACA
JMFF044G18- AAACCATCGGGAAGAGAGTGGCGGCATCCATACAAGTTGTCAAACTTGCTCTTGGTTACA
JMFF044E10+ AAACCATCGGGAAGAGAGTGGCGGCATCCATACAAGTTGTCAAACTTGCTCTTGGTTACA
JMFN038J21+ AAACCATCGGGAAGAGAGTGGCGGCATCCATACAAGTTGTCAAACTTGCTCTTGGTTACA
                      ____________________________________________________________
consensus AAACCATCGGGAAGAGAGTGGCGGCATCCATACAAGTTGTCAAACTTGCTCTTGGTTACA
 
. : . : . : . : . : . :
JMFS054E10+ GAGTCGTTGACATTAATGGCGGGGAAAAGAAGAGTTCCACTCTCCTGCATCTGA
rJMFF044G18+ GAGTCGTTGACATTAATGGCGGGGAAAAGAAGAGTTCCACTCTCCTGCATCTGATAAAGT
JMSF002C24- GAGTCGTTGACATTAATGGCGGGGAAAAGAAGAGTTCCACTCTCCTGCATCTGATAAAGT
JMFF044G18- GAGTCGTTGACATTAATGGCGGGGAAAAGAAGAGTTCCACTCTCCTGCATCTGATAAAGT
JMFF044E10+ GAGTCGTTGACATTAATGGCGGGGAAAAGAAGAGTTCCACTCTCCTGCATCTGATAAAGT
JMFN038J21+ GAGTCGTTGACATTAATGGCGGGGAAAAGAAGAGTTCCACTCTCCTGCATCTGATAAAGT
                      ____________________________________________________________
consensus GAGTCGTTGACATTAATGGCGGGGAAAAGAAGAGTTCCACTCTCCTGCATCTGATAAAGT
 
. : . : . : . : . : . :
rJMFF044G18+ CTCTTGACACCAGTAGTGGTCTCCTCGGAAACACCGACGAGTCTCTCCTTCATCCTGGTG
JMSF002C24- CTCTTGACACCAGTAGTGGTCTCCTCGGAAACACCGACGAGTCTCTCCTTCATCCTGGTG
JMFF044G18- CTCTTGACACCAGTAGTGGTCTCCTCGGAAACACCGACGAGTCTCTCCTTCATCCTGGTG
JMFF044E10+ CTCTTGACACCAGTAGTGGTCTCCTCGGAAACACCGACGAGTCTCTCCTTCATCCTGGTG
JMFN038J21+ CTCTTGACACCAGTAGTGGTCTCCTCGGAAACACCGACGAGTCTCTCCTTCATCCTGGTG
JMFN009N16+ CGACGAGTCTCTCCTTCATCCTGGTG
JMFS088F02+ G
JMSF032A20+ CTCCTTCATCCTGGTG
                      ____________________________________________________________
consensus CTCTTGACACCAGTAGTGGTCTCCTCGGAAACACCGACGAGTCTCTCCTTCATCCTGGTG
 
. : . : . : . : . : . :
rJMFF044G18+ TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMSF002C24- TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMFF044G18- TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMFF044E10+ TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMFN038J21+ TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMFN009N16+ TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMSF039O11+ GGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMSF052P08+ GTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMFS133H06+ TGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMFN018F01+ GATGATGGTGAGGACAATCTGGAACTCG
JMFF042F24+ TGATGATGGTGAGGACAATCTGGAACTCG
JMFF049M24+ TCTGATGATGGTGAGGACAATCTGGAACTCG
JMFS088F02+ TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMSF048E24+ CTGATGATGGTGAGGACAATCTGGAACTCG
JMFS052H08+ TGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMSF032A20+ TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
JMFF050P08+ AGGACAATCTGGAACTCG
JMFF043F01+ GAGGACAATCTGGAACTCG
JMFF050C13+ CG
JMFN018G06+ GGAACTCG
JMFF042F17+ TGAGGACAATCTGGAACTCG
                      ____________________________________________________________
consensus TACTTCTTGGGATCGGCCTTGAGGCCGTCTCTGATGATGGTGAGGACAATCTGGAACTCG
 
. : . : . : . : . : . :
rJMFF044G18+ GCATTGTCGGTGGAGC
JMSF002C24- GCATTG
JMFF044G18- GCATTGTCGGTGGAGC
JMFF044E10+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFN038J21+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFN009N16+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMSF039O11+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMSF052P08+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFS133H06+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFN018F01+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF042F24+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF049M24+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFS088F02+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMSF048E24+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFS052H08+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMSF032A20+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF050P08+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF043F01+ GCATNGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF050C13+ GCATTGTCGGTGGAGCTGGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF047B14+ TTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF016N16+ AACGGTGCCGTTTTTGGCGTACTCCTCNTCGGCC
JMFF045A03+ GATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF050M20+ GCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF032D23+ TGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF010J16+ GCC
JMFF008E18+ CC
JMFF019N20+ C
JMFF010I01+ C
JMFF014D10+ GCGTACTCCTCNTCGGCC
JMFF004L06+ GAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF046A02+ CCGGAACGGTGCCGTNTTTGGCGTACTCCTCCTCGGCC
JMFF051O15+ CGGAACGGTG-CGTTTTTGGCGTACTCCTCCTCGGCC
JMFN018G06+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMSF018J09+ CTCGGCC
JMFF018A02+ C
JMFF031J12+ GCC
JMFF005A22+ C
JMFS040C03+ TCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
JMFF042F17+ GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
                      ____________________________________________________________
consensus GCATTGTCGGTGGAGCTTGGATCCGGAACGGTGCCGTTTTTGGCGTACTCCTCCTCGGCC
 
. : . : . : . : . : . :
JMFF044E10+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFN038J21+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFN009N16+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMSF039O11+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMSF052P08+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFS133H06+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFN018F01+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF042F24+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF049M24+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGCCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFS088F02+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMSF048E24+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGN
JMFS052H08+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMSF032A20+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF050P08+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF043F01+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGATGATGAGATCCGGG
JMFF050C13+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF047B14+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMSF018A12+ GTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF016N16+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF045A03+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF050M20+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF032D23+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF010J16+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF008E18+ TTGACGCCNTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF019N20+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGNCGATGAGATCCGGG
JMFF010I01+ TTGACGCCNTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF047O17+ GAGGGGGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF036B05+ CGTCGTCGACGATGAGATCCGGG
JMFF032D22+ GTCGTCGACGATGAGATCCGGG
JMFF021H20+ TCGACGATGAGATCCGGG
JMFF030J03+ ACGATGAGATCCGGG
JMFF034K14+ GTCGACGATGAGATCCGGG
JMFF014D10+ TTGACGCCCTCGTGGATCAAGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF004L06+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF046A02+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF051O15+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFN018G06+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMSF018J09+ TTGACGCCNTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF018A02+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF031J12+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF005A22+ TTGACGCCNTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF035B06+ CGTCGACGATGAGATCCGGG
JMFF019J06+ TCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFF051L19+ TGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMFS040C03+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
JMSF014I15+ TCGTCGACGATGAGATCCGGG
JMFF022C17+ CGTCGTCGACGATGAGATCCGGG
JMFF042F17+ TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
                      ____________________________________________________________
consensus TTGACGCCCTCGTGGATGAGGAGGGTGGCGTCGCCGCCGTCGTCGACGATGAGATCCGGG
 
. : . : . : . : . : . :
JMFF044E10+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFN038J21+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFN009N16+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF039O11+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF052P08+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFS133H06+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFN018F01+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF042F24+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF049M24+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFS088F02+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF048E24+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFS052H08+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF032A20+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF050P08+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF043F01+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF050C13+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF047B14+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF018A12+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF016N16+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF045A03+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF050M20+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF032D23+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF010J16+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF008E18+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF019N20+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF010I01+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF047O17+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF036B05+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF032D22+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF021H20+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF030J03+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCAC-AGTACTCCTGGAGAGT
JMFF034K14+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF014D10+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACAAGTACTCCTGGAGGGT
JMFF004L06+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF046A02+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF051O15+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFN018G06+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF018J09+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF018A02+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTGCCACCACCAGTACTCCTGGAGAGT
JMFF031J12+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTGCCACCACCAGTACTCCTGGAGAGT
JMFF005A22+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTGGCACCACCAGTACTCCTGGAGAGT
JMFF035B06+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF019J06+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF051L19+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFS040C03+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF014I15+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF022C17+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF024O02+ CGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMSF012M07+ CAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF038B22+ CACCACCAGTACTCCTGGAGAGT
JMFF021B15+ TG-CACCACCAGTACTCCTGGAGAGT
JMFF047K05+ CCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF003G19+ CGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
JMFF010H21+ CAGTCGAGGGCCCTCTCCGTGCCACCACCAGTACTCCTGGAGAGT
JMFF024E14+ GTG-CACCACCAGTACTCCTGGAGAGT
JMFF025A07+ CACCACCAGTACTCCTGGAGAGT
JMFF042F17+ CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
                      ____________________________________________________________
consensus CCGCCGCCGGGGCCCCAGTCGAGGGCCCTCTCCGTG-CACCACCAGTACTCCTGGAGAGT
 
. : . : . : . : . : . :
JMFF044E10+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFN038J21+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFN009N16+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF039O11+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF052P08+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFS133H06+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFN018F01+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF042F24+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF049M24+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFS088F02+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF048E24+ CTCCCCTTTCCAGGNGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFS052H08+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF032A20+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF050P08+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF043F01+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF050C13+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF047B14+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF018A12+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF023H12+ GGCGGCGGCGGCGTGGT
JMFF016N16+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF045A03+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF050M20+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF032D23+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF010J16+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF008E18+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF019N20+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF010I01+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF047O17+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF036B05+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF032D22+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF021H20+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF030J03+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF034K14+ CTCCCCTTTCCAGGCGAAGACGGCGGCCGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF014D10+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGATGGCGGCGGCGGCGTGGT
JMFF004L06+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF046A02+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF051O15+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFN018G06+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF018J09+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF018A02+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF031J12+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF005A22+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF035B06+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF019J06+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF051L19+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFS040C03+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF014I15+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF022C17+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF024O02+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF012M07+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF038B22+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF021B15+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF047K05+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF003G19+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF010H21+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF024E14+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMFF025A07+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
JMSF001N13+ GAAGACGGCGG-CGCTNTCGCNGGCGACGGCGGCGGCGGCGTGNT
JMFF042F17+ CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
                      ____________________________________________________________
consensus CTCCCCTTTCCAGGCGAAGACGGCGG-CGCTGTCGCGGGCGACGGCGGCGGCGGCGTGGT
 
. : . : . : . : . : . :
JMFF044E10+ CCTGGGTGGAGAAGATGTTGCAGTAGCA
JMFN038J21+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFN009N16+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF039O11+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF052P08+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFS133H06+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFN018F01+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF042F24+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF049M24+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFS088F02+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF048E24+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFS052H08+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF032A20+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF050P08+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF043F01+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF050C13+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF047B14+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF018A12+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF023H12+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF004C13+ GGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF016N16+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF045A03+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF050M20+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF032D23+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF010J16+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF008E18+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF019N20+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF010I01+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF047O17+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF036B05+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF032D22+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF021H20+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF030J03+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF034K14+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF014D10+ CCTGGGTTGATAAGATGTTGCAGGAGCACCATCTGACTTCGGCGCTGAGGGCGGTGAGGG
JMFF004L06+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF046A02+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF051O15+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFN018G06+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF018J09+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF018A02+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF031J12+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF005A22+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF035B06+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF019J06+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF051L19+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFS040C03+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF014I15+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF022C17+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF024O02+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF012M07+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF038B22+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF021B15+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCT-AGCGCCGAGGGCGGTGAGGG
JMFF047K05+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF004J20+ TGGAGAAGATGTTGCAGGAGCCCCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF003G19+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF010H21+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF024E14+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF025A07+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMSF001N13+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
JMFF042F17+ CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
                      ____________________________________________________________
consensus CCTGGGTGGAGAAGATGTTGCAGGAGCACCATCTGACCTCGGCGCCGAGGGCGGTGAGGG
 
. : . : . : . : . : . :
JMFN038J21+ TCTCGATCAGGACGGCGGTTT
JMFN009N16+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF039O11+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF052P08+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFS133H06+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFN018F01+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF042F24+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF049M24+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFS088F02+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF048E24+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFS052H08+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF032A20+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF050P08+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF043F01+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF050C13+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF047B14+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF018A12+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF023H12+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF004C13+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF016N16+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF045A03+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF050M20+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF032D23+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF010J16+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF008E18+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF019N20+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF010I01+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF047O17+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF036B05+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF032D22+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF021H20+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF030J03+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF034K14+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF014D10+ TCTCGATCAGGACGGCGGTATCGATGGTGATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF004L06+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF046A02+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF051O15+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFN018G06+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF018J09+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF018A02+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF031J12+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF005A22+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF035B06+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF019J06+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF051L19+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFS040C03+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF014I15+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF022C17+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF024O02+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF012M07+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF038B22+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF021B15+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF047K05+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF004J20+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF048P03+ CATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF003G19+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF010H21+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF024E14+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF025A07+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF001N13+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMSF004A11+ GACGGCGGTATCGATGGTGATATGCAAACTGCCGGTGATCCTGGCGCCCT
JMFF042F17+ TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
                      ____________________________________________________________
consensus TCTCGATCAGGACGGCGGTTTGGATGGTCATATGCAAACTGCCGGTGATCCTGGCGCCCT
 
. : . : . : . : . : . :
JMFN009N16+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF039O11+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF052P08+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFS133H06+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFN018F01+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF042F24+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF049M24+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFS088F02+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF048E24+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFS052H08+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF032A20+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF050P08+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF043F01+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF050C13+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF047B14+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF018A12+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF023H12+ TGAAGGGCTGGGAAGGCCCGAATTNGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF004C13+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF016N16+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF045A03+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF050M20+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF032D23+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF010J16+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF008E18+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF019N20+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF010I01+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF047O17+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF036B05+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF032D22+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF021H20+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF030J03+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF034K14+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF014D10+ TGAAGGGCTGGGAAGGTCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF004L06+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF046A02+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF051O15+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFN018G06+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF018J09+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF018A02+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF031J12+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF005A22+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF035B06+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF019J06+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF051L19+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFS040C03+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF014I15+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF022C17+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF024O02+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF012M07+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF038B22+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF021B15+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF047K05+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF004J20+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF048P03+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF022M12+ GCCCAGGCATTTCAACCT
JMFF003G19+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF010H21+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF024E14+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF025A07+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF001N13+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF018K13+ GAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMSF004A11+ TGAAGGGCTGGGAAGGTCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
JMFF042F17+ TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
                      ____________________________________________________________
consensus TGAAGGGCTGGGAAGGCCCGAATTCGGCCCGGCAAGCCATGAGCCCAGGCATTTCAACCT
 
. : . : . : . : . : . :
JMFN009N16+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF039O11+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF052P08+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFS133H06+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFN018F01+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF042F24+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF049M24+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFS088F02+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF048E24+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCNTGAGACATGTCCTTGACCTTGTACT
JMFS052H08+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF032A20+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF050P08+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF043F01+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF050C13+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF047B14+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF018A12+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF023H12+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGACNTGAGACATGTCCTTGACCTTGTACT
JMSF004C13+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF016N16+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF045A03+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF050M20+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF032D23+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF010J16+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF008E18+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF019N20+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF010I01+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF047O17+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF036B05+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF032D22+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF021H20+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF030J03+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF034K14+ CGGCGAGCTNTAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF014D10+ CGGCGATCTCAACTTCGAGCCGGCCGAAATTGGCCTGGGACATGTCCTTCACCTTGTACT
JMFF004L06+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF046A02+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF051O15+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFN018G06+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF018J09+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF018A02+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF031J12+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF005A22+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF035B06+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF019J06+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF051L19+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFS040C03+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF014I15+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF022C17+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF024O02+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF012M07+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF038B22+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF021B15+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF047K05+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF004J20+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF048P03+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF022M12+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF003G19+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF010H21+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF024E14+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMFF025A07+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCNTGAGACATGTCCTNGACCTTGTACT
JMSF001N13+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF018K13+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
JMSF004A11+ CGGCGATCTCAACTTCGAGCCGGCCGAAATTGGCCTGGGACATGTCCTTCACCTTGTACT
JMFF042F17+ CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
                      ____________________________________________________________
consensus CGGCGAGCTCCAATTCGAGCCGCCCGAAATCGGCCTGAGACATGTCCTTGACCTTGTACT
 
. : . : . : . : . : . :
JMFN009N16+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF039O11+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF052P08+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFS133H06+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFN018F01+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF042F24+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF049M24+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFS088F02+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF048E24+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFS052H08+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF032A20+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF050P08+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF043F01+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF050C13+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF047B14+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF018A12+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF023H12+ CGCGGCCGGAACTGNTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF004C13+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF016N16+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF045A03+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF050M20+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF032D23+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF010J16+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF008E18+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF019N20+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF010I01+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF047O17+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF036B05+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF032D22+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF021H20+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF030J03+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF034K14+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF014D10+ CGCGGCCGGAGGTGGTTTTCTCGACGATCAAAGCCATGGGTAGAGAG
JMFF004L06+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF046A02+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF051O15+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFN018G06+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF018J09+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF018A02+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF031J12+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF005A22+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF035B06+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF019J06+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF051L19+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFS040C03+ CGCGGCCGGAACTGGTTTTCTCGACGGTCA
JMSF014I15+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF022C17+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF024O02+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF012M07+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF038B22+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF021B15+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF047K05+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF004J20+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF048P03+ CGCGGCCGGAGCTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATGTAACAGT
JMFF022M12+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF003G19+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF010H21+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF024E14+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMFF025A07+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF001N13+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF018K13+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
JMSF004A11+ CGCGGCCGGAGGTGGTTTTCTCGACGATCAAAGCCATGGGTAGAGAG
JMFF042F17+ CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
                      ____________________________________________________________
consensus CGCGGCCGGAACTGGTTTTCTCGACGGTCAAAGCCATGGGTAGAGAGAGTATG-AACAGT
 
. : . : . : . : . : . :
JMFN009N16+ AGGGGGAG
JMSF039O11+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGT
JMSF052P08+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCC
JMFS133H06+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGG
JMFN018F01+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTC
JMFF042F24+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF049M24+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFS088F02+ AGGGGGAGTAGATCTGG
JMSF048E24+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCC
JMFS052H08+ AGGGGGAGTAGATC
JMSF032A20+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCC
JMFF050P08+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF043F01+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF050C13+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF047B14+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMSF018A12+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCC
JMSF023H12+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTANGAAGAAGCGAGTGTGCC
JMSF004C13+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCC
JMFF016N16+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCC
JMFF045A03+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCC
JMFF050M20+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAG
JMFF032D23+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF010J16+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTG
JMFF008E18+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF019N20+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF010I01+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF047O17+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAG
JMFF036B05+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF032D22+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF021H20+ AGGGAGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF030J03+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGT
JMFF034K14+ AGGGGGAGTAGATCTGGGCCTCTNTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF004L06+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF046A02+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF051O15+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFN018G06+ AGGGGGAGTAGA
JMSF018J09+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCA
JMFF018A02+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF031J12+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF005A22+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF035B06+ AGGGGGTGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAG
JMFF019J06+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAG
JMFF051L19+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAG
JMSF014I15+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAG
JMFF022C17+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF024O02+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMSF012M07+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGT
JMFF038B22+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF021B15+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF047K05+ AGGGGGAGTAGATCTGGGCCT
JMFF004J20+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF048P03+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGA
JMFF022M12+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF003G19+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF010H21+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGC
JMFF024E14+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAG
JMFF025A07+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTG
JMSF001N13+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAG
JMSF018K13+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAG
JMFF042F17+ AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAGGCG
                      ____________________________________________________________
consensus AGGGGGAGTAGATCTGGGCCTCTCTTCTTCTGGGTTTAGGAAGAAGCGAGTGTGCAGGCG