Previous Contig 001806:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I02Sequence612001806 (7)gb:BT004742_16377762e-26Arabidopsis thaliana At1g21930 gene, complete cds.
JMFF042F14Sequence611001806 (7)gb:BT004742_16377762e-26Arabidopsis thaliana At1g21930 gene, complete cds.555001806 (7)gb:BT004742_16377762e-26Arabidopsis thaliana At1g21930 gene, complete cds.
JMFN011O18Sequence542001806 (7)gb:BT004742_16377762e-26Arabidopsis thaliana At1g21930 gene, complete cds.
JMFN031P18Sequence607001806 (7)gb:BT004742_16377762e-26Arabidopsis thaliana At1g21930 gene, complete cds.
JMSF028J18Sequence678001806 (7)gb:BT004742_16377763e-26Arabidopsis thaliana At1g21930 gene, complete cds.627001806 (7)gb:BT004742_16377762e-26Arabidopsis thaliana At1g21930 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028J18+ TTTT
                      ____________________________________________________________
consensus TTTT
 
. : . : . : . : . : . :
rJMSF028J18- TTGAGTATTTACC
JMSF028J18+ TTTTTTGGAACATAATTCAAAAGCAATGAACATTACCCACAGCTGTATTGAGTATTTACC
                      ____________________________________________________________
consensus TTTTTTGGAACATAATTCAAAAGCAATGAACATTACCCACAGCTGTATTGAGTATTTACC
 
. : . : . : . : . : . :
rJMSF028J18- ACAATTGTAATGACCATTTACTTCAAGATGGTATTCCACTTGTTGGTTTCATAAATGTAA
JMSF028J18+ ACAATTGTAATGACCATTTACTTCAAGATGGTATTCCACTTGTTGGTTTCATAAATGTAA
rJMFF042F14- GGTTTCATAAATGTAA
JMFN011O18+ AAATGTAA
JMFF003I02+ CATTTACTTCAAGATGGTATTCCACTTGTTGGTTTCATAAATGTAA
JMFN031P18+ TTCATAAATGTAA
JMFF042F14+ CATAAATGTAA
                      ____________________________________________________________
consensus ACAATTGTAATGACCATTTACTTCAAGATGGTATTCCACTTGTTGGTTTCATAAATGTAA
 
. : . : . : . : . : . :
rJMSF028J18- TGATGATTTATTAGACTAATTTTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
JMSF028J18+ TGATGATTTATTAGACTAATTTTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
rJMFF042F14- TGATGATTTATTAGACTAATTTTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
JMFN011O18+ TGATGATTTATTAGACTAATTTTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
JMFF003I02+ TGATGATTTATTAGACTAATTTTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
JMFN031P18+ TGATGATTTATTAGACTAATTNTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
JMFF042F14+ TGATGATTTATTAGACTAATTNTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
                      ____________________________________________________________
consensus TGATGATTTATTAGACTAATTTTAACAGAAACGTTTAACAGAAAAATTTGGACTAAATGC
 
. : . : . : . : . : . :
rJMSF028J18- CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATTTGCGTGCGTG
JMSF028J18+ CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATTTGCGTGCGTG
rJMFF042F14- CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATTTGCGTGCGTG
JMFN011O18+ CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATNTGCGTGCGTG
JMFF003I02+ CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATTTGCGTGCGTG
JMFN031P18+ CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATTTGCGTGCGTG
JMFF042F14+ CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATTTGCGTGCGTG
                      ____________________________________________________________
consensus CAAAATTTGACAGCCACAGAATCGAAAGCAATCCAACAAAAGAAGTGATTTGCGTGCGTG
 
. : . : . : . : . : . :
rJMSF028J18- CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGCA
JMSF028J18+ CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGCA
rJMFF042F14- CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGCA
JMFN011O18+ CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGCA
JMFF003I02+ CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGCA
JMFN031P18+ CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGAA
JMFF042F14+ CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGCA
                      ____________________________________________________________
consensus CCTGAGTGCCATCATGATTCGGCTCTGGCTCCGGCTCCAATATTGGGCAATGCATCAGCA
 
. : . : . : . : . : . :
rJMSF028J18- GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
JMSF028J18+ GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
rJMFF042F14- GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
JMFN011O18+ GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
JMFF003I02+ GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
JMFN031P18+ GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
JMFF042F14+ GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
                      ____________________________________________________________
consensus GCTGCGGCAGCAGAATTTTGTGCTTCCAAAAGCTTCTGGCGTTCTGCGTGTTCTCTTTCA
 
. : . : . : . : . : . :
rJMSF028J18- CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
JMSF028J18+ CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
rJMFF042F14- CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
JMFN011O18+ CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
JMFF003I02+ CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
JMFN031P18+ CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
JMFF042F14+ CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
                      ____________________________________________________________
consensus CAGGCACTGATTCCCATAATTATATCAAGCATGGTTCCAGTTGTCCCGAAGAATACAAGG
 
. : . : . : . : . : . :
rJMSF028J18- GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
JMSF028J18+ GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
rJMFF042F14- GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
JMFN011O18+ GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
JMFF003I02+ GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
JMFN031P18+ GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
JMFF042F14+ GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
                      ____________________________________________________________
consensus GGCGCCAAAGATTTCCGCTTTATCCCCACAGGTATTGCAAGCAAAGCACCAGCTACTGAA
 
. : . : . : . : . : . :
rJMSF028J18- AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
JMSF028J18+ AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
rJMFF042F14- AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
JMFN011O18+ AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
JMFF003I02+ AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
JMFN031P18+ AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
JMFF042F14+ AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
                      ____________________________________________________________
consensus AAAACCCATGTCCCAAGTGCATTGGAAACAGAGCATTCCTCAAGTTGTTTCACAGGTTGT
 
. : . : . : . : . : . :
rJMSF028J18- GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
JMSF028J18+ GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
rJMFF042F14- GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
JMFN011O18+ GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
JMFF003I02+ GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
JMFN031P18+ GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
JMFF042F14+ GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
                      ____________________________________________________________
consensus GCATCTTGTCCGGCCATCACTCTTGGCGCATCTCTTTAGCCTCTGCAGGAATTGGAGTAG
 
. : . : . : . : . : . :
rJMSF028J18- ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAGAAACGA
JMSF028J18+ ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAGAAACGA
rJMFF042F14- ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAGAAACG
JMFN011O18+ ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAG
JMFF003I02+ ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAGAAACGA
JMFN031P18+ ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAGAAACGA
JMFF042F14+ ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAGAAACGA
                      ____________________________________________________________
consensus ACCGTAAGAGCAATCAGAGAAATTGGCTTCGAGGAGAGAAGCGATAGAATGGAGAAACGA
 
. : . : . : . : . : . :
rJMSF028J18- GAACAGAGATTCT
JMSF028J18+ GAACAGAGATTCT
JMFF003I02+ GAACAGAGATTCTGAGAGTGAAAACT
JMFN031P18+ GAACAGAGATTCTGAGAGTGAAAACTGAGAACTAGGGTTTCGATTTACCACTTA
JMFF042F14+ GAACAGAGATTCTGAGAGTGAAAACTGAGAACTAGGGTTTCGATTTACCACTTACAAAGT
                      ____________________________________________________________
consensus GAACAGAGATTCTGAGAGTGAAAACTGAGAACTAGGGTTTCGATTTACCACTTACAAAGT