Previous Contig 001804:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C24Sequence473001804 (183)pir|S07942|CDKV5e-76chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF003I05Sequence469001804 (183)gb:AB012638_15118845e-65Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b673001804 (183)pir|S07942|CDKVe-116chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF008N20Sequence555001804 (183)gb:AB012638_15118849e-82Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b690001804 (183)pir|S07942|CDKVe-118chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF010E19Sequence558001804 (183)gb:AB012638_15118849e-82Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b716001804 (183)pir|S07942|CDKVe-129chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF010J11Sequence427001804 (183)gb:AB012638_15118848e-57Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b661001804 (183)pir|S07942|CDKVe-107chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF013M10Sequence456001804 (183)gb:AB012638_15118849e-63Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b709001804 (183)pir|S07942|CDKVe-128chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF013M21Sequence339001804 (183)pir|T09838|T098386e-43chlorophyll a/b binding protein precursor - upland cotton chloroplast>gb:COTIIAB
JMFF016C15Sequence475001804 (183)gb:AB012638_15118845e-65Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b724001804 (183)gb:AB006081_1509749e-118Fagus crenata mRNA for chlorophyll a/b-binding protein, complete cds.
JMFF016M24Sequence552001804 (183)gb:AB012638_15118846e-80Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b729001804 (183)pir|S07942|CDKVe-128chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF022B14Sequence558001804 (183)gb:AB012638_15118849e-80Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b645001804 (183)pir|S07942|CDKVe-110chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF025F24Sequence560001804 (183)gb:AB012638_15118842e-82Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b793001804 (183)pir|S07942|CDKVe-133chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF025H07Sequence469001804 (183)gb:AB012638_15118843e-63Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b641001804 (183)pir|S07942|CDKVe-100chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF028A13Sequence469001804 (183)gb:AB012638_15118845e-65Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b657001804 (183)pir|S07942|CDKV2e-95chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF028H08Sequence553001804 (183)gb:AB012638_15118849e-82Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b716001804 (183)pir|S07942|CDKVe-128chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF030M20Sequence411001804 (183)gb:AF279250_17828031e-52Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, co
JMFF031L08Sequence458001804 (183)gb:S73603_17044843e-41Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds.668001804 (183)pir|S07942|CDKVe-108chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF032A06Sequence548001804 (183)gb:AB012638_15118842e-80Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b737001804 (183)pir|S07942|CDKVe-129chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF036K09Sequence564001804 (183)gb:AB012638_15118842e-83Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b661001804 (183)pir|S07942|CDKVe-116chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFF037A05Sequence533005183 (3)gb:AY081294_15686409e-28Arabidopsis thaliana unknown protein (At4g25610) mRNA, complete cds.>gb:BT000386296001804 (183)sp|P09755|CB22_SOYBN2e-39Chlorophyll a-b binding protein 2, chloroplast precursor (LHCII type I CAB-2) (L
JMFF042F03Sequence644001804 (183)gb:AB012638_15118841e-97Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b565001804 (183)pir|T09838|T098387e-40chlorophyll a/b binding protein precursor - upland cotton chloroplast>gb:COTIIAB
JMFN005C09Sequence627001804 (183)gb:AB012638_1511884e-101Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN006D08Sequence611001804 (183)sp|P12329|CB21_MAIZEe-114Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMFN006P06Sequence633001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFN008G20Sequence626001804 (183)gb:AB012638_15118843e-99Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN009D05Sequence609001804 (183)sp|P12329|CB21_MAIZEe-114Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMFN010O04Sequence627001804 (183)gb:AB012638_15118842e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN011K21Sequence536001804 (183)pir|S07942|CDKV1e-66chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFN011L18Sequence625001804 (183)gb:AB012638_1511884e-100Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN012K19Sequence475001804 (183)pir|S07942|CDKV2e-70chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFN013E02Sequence635001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFN014I15Sequence614001804 (183)gb:AB012638_15118843e-95Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN016K18Sequence441001804 (183)gb:AB012638_15118841e-57Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN017L08Sequence628001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN017P04Sequence577001804 (183)gb:AB012638_15118844e-90Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN018E22Sequence596001804 (183)pir|S07942|CDKV1e-86chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFN018P05Sequence577001804 (183)gb:AB012638_15118841e-89Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFN030A02Sequence604001804 (183)pir|S07942|CDKV1e-91chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFN030N08Sequence533001804 (183)pir|S07942|CDKV2e-80chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFN037E19Sequence612001804 (183)gb:AB012638_15118843e-95Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS033C02Sequence558001804 (183)pir|S07942|CDKV1e-86chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFS043B11Sequence548001804 (183)pir|S07942|CDKV1e-86chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMFS048D04Sequence575001804 (183)gb:AB012638_15118841e-89Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS061G02Sequence627001804 (183)gb:AB012638_15118842e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS088A03Sequence605001804 (183)gb:AB012638_15118843e-95Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS099B07Sequence606001804 (183)gb:AB012638_15118843e-95Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS102E07Sequence617001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS103C08Sequence555001804 (183)gb:AB012638_15118843e-85Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS115H10Sequence627001804 (183)gb:AB012638_15118842e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMFS158G06Sequence492001804 (183)gb:AB012638_15118847e-73Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMSF001F06Sequence459001804 (183)gb:AB012638_15118842e-61Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b774001804 (183)pir|S07942|CDKVe-132chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF002F06Sequence447001804 (183)gb:AB012638_15118841e-57Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b719001804 (183)sp|P12329|CB21_MAIZEe-131Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF002N06Sequence368001804 (183)gb:AB012638_15118846e-43Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b750001804 (183)sp|P12329|CB21_MAIZEe-133Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF006H09Sequence439001804 (183)gb:AB012638_15118842e-57Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b584001804 (183)pir|S07942|CDKV1e-99chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF006H11Sequence272004807 (3)gb:AY051004_15624820.011Arabidopsis thaliana putative arsA homolog hASNA-I (At1g01910) mRNA, complete cd147001804 (183)gb:AY198376_15889776e-13Citrus limon chlorophyll a/b-binding protein precursor, gene, partial cds; nucle
JMSF006K24Sequence313001804 (183)gb:AB012638_15118849e-34Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMSF006O13Sequence266001804 (183)pir|S23210|S232102e-22chlorophyll a/b-binding protein type I - potato>gb:STCABPSII_1722733 S.tuberosum
JMSF006O15Sequence209007902 (3)pir|B86359|B863597e-05protein Similar to LeOPT1 [Lycopersicon esculentum] [imported] - Arabidopsis tha386001804 (183)pir|S07942|CDKV4e-58chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF007C22Sequence356001804 (183)gb:AB012638_15118842e-41Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b755001804 (183)sp|P12329|CB21_MAIZEe-133Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF007H09Sequence343000630 (3)gb:AC084320_17335167e-29Oryza sativa chromosome 3 BAC OSJNBa0091J19 genomic sequence, complete sequence.771001804 (183)pir|S07942|CDKVe-135chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF008F17Sequence444001804 (183)gb:AB012638_15118843e-60Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMSF008L08Sequence347001804 (183)gb:AB012638_15118844e-41Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b734001804 (183)pir|S07942|CDKVe-113chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF011M21Sequence250001804 (183)gb:PHNCABBP_17001428e-22Japanese morning glory mRNA for chlorophyl a/b binding protein, partial cds.712001804 (183)pir|S07942|CDKVe-129chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF012C24Sequence211001804 (183)gb:PHNCABBP_17001425e-16Japanese morning glory mRNA for chlorophyl a/b binding protein, partial cds.676010234 (6)gb:AY136418_15819192e-89Arabidopsis thaliana putative DNA polymerase delta small subunit (At2g42120) mRN
JMSF013D16Sequence453001804 (183)gb:AB012638_15118845e-62Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b773001804 (183)pir|S07942|CDKVe-136chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF013K21Sequence259001804 (183)pir|S23210|S232102e-22chlorophyll a/b-binding protein type I - potato>gb:STCABPSII_1722733 S.tuberosum748001804 (183)sp|P12329|CB21_MAIZEe-132Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF013M07Sequence461001804 (183)gb:AB012638_15118845e-62Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b704022567gb:AF451278_18008196e-19Phaseolus vulgaris ubiquitin-like protein SMT3 (SMT3) mRNA, partial cds.
JMSF015N09Sequence449001804 (183)gb:AB012638_15118841e-61Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b773001804 (183)pir|S07942|CDKVe-135chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF015P15Sequence456001804 (183)gb:AB012638_15118849e-63Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b767001804 (183)pir|S07942|CDKVe-135chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF016H19Sequence266001804 (183)pir|S23210|S232102e-22chlorophyll a/b-binding protein type I - potato>gb:STCABPSII_1722733 S.tuberosum786001804 (183)pir|S07942|CDKVe-137chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF016I18Sequence466001804 (183)gb:AB012638_15118847e-63Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b770001804 (183)pir|S07942|CDKVe-135chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF017O12Sequence455001804 (183)gb:AB012638_15118843e-62Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b776001804 (183)pir|S07942|CDKVe-134chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF018D15Sequence459001804 (183)gb:AB012638_15118847e-63Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b799001804 (183)pir|S07942|CDKVe-140chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF019G18Sequence448001804 (183)gb:AB012638_15118846e-62Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b770001804 (183)sp|P12329|CB21_MAIZEe-133Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF019J06Sequence599001804 (183)gb:AB012638_15118848e-90Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b696001804 (183)pir|S07942|CDKVe-112chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF021J23Sequence692007059 (9)gb:AY087672_15727008e-27Arabidopsis thaliana clone 37543 mRNA, complete sequence.758001804 (183)sp|P12329|CB21_MAIZEe-133Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF022C13Sequence637001804 (183)gb:AB012638_15118848e-97Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b713001804 (183)pir|S07942|CDKVe-128chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF022D03Sequence656001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)766001804 (183)pir|S07942|CDKVe-135chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF024I07Sequence642001804 (183)sp|P04781|CB23_PETSP2e-89Chlorophyll a-b binding protein 22R, chloroplast precursor (LHCII type I CAB-22R709001804 (183)pir|JA0179|JA0179e-120chlorophyll a/b-binding protein precursor - soybean (fragment)
JMSF025H17Sequence568001804 (183)gb:AB012638_15118848e-81Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMSF025M18Sequence693007852 (4)gb:AC069473_15408921e-26Arabidopsis thaliana chromosome 3 BAC T21B14 genomic sequence, complete sequence755001804 (183)pir|S07942|CDKVe-127chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF025M22Sequence637001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b766001804 (183)sp|P12329|CB21_MAIZEe-133Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF026L18Sequence637001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b776001804 (183)pir|S07942|CDKVe-135chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF026M16Sequence671006409 (3)gb:AP003077_18246771e-78Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P052670001804 (183)pir|S07942|CDKVe-118chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF026N16Sequence657001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)771001804 (183)pir|S07942|CDKVe-135chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF026O13Sequence637001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b739001804 (183)sp|P12329|CB21_MAIZEe-131Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF030P07Sequence638001804 (183)gb:AB012638_15118842e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b739001804 (183)pir|S07942|CDKVe-126chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF031N09Sequence625007852 (4)gb:AC069473_15408926e-14Arabidopsis thaliana chromosome 3 BAC T21B14 genomic sequence, complete sequence749001804 (183)pir|S07942|CDKVe-126chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF033N19Sequence663001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)656001804 (183)pir|S07942|CDKVe-116chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF033N23Sequence643001804 (183)gb:AB012638_15118841e-97Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b615001804 (183)pir|S07942|CDKVe-107chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF034L09Sequence645001804 (183)gb:AB012638_15118842e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b703001804 (183)pir|S07942|CDKVe-127chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF037H11Sequence663001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)756001804 (183)pir|S07942|CDKVe-134chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF037N01Sequence642001804 (183)gb:AB012638_15118841e-97Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b643001804 (183)pir|S07942|CDKVe-113chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF038E23Sequence665001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)865001804 (183)pir|S07942|CDKVe-140chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF039D13Sequence655001804 (183)gb:AB012638_1511884e-101Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b853001804 (183)pir|S07942|CDKVe-140chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF039H13Sequence636001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b893001804 (183)gb:AB012638_1511884e-141Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMSF039O08Sequence636001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b808001804 (183)gb:AB012638_1511884e-141Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMSF040P20Sequence605001804 (183)gb:AB012638_15118845e-90Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b829001804 (183)gb:AB012638_1511884e-141Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b
JMSF041K21Sequence786001804 (183)pir|S07942|CDKVe-123chlorophyll a/b-binding protein precursor - cucumber (fragment)773001804 (183)pir|S07942|CDKVe-136chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF042F09Sequence707001804 (183)pir|S07942|CDKVe-109chlorophyll a/b-binding protein precursor - cucumber (fragment)816001804 (183)pir|S07942|CDKVe-141chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF043B16Sequence388001804 (183)gb:CAR131044_16451435e-67Cicer arietinum mRNA for chlorophyll a/b binding protein.
JMSF043J21Sequence774001804 (183)pir|S07942|CDKVe-124chlorophyll a/b-binding protein precursor - cucumber (fragment)714001804 (183)pir|S07942|CDKVe-128chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF043N04Sequence772001804 (183)pir|S07942|CDKVe-124chlorophyll a/b-binding protein precursor - cucumber (fragment)742001804 (183)pir|S07942|CDKVe-129chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF045H15Sequence686001804 (183)pir|S07942|CDKVe-106chlorophyll a/b-binding protein precursor - cucumber (fragment)748001804 (183)sp|P12329|CB21_MAIZEe-132Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF046I16Sequence790001804 (183)sp|P04781|CB23_PETSPe-117Chlorophyll a-b binding protein 22R, chloroplast precursor (LHCII type I CAB-22R763001804 (183)sp|P04781|CB23_PETSPe-126Chlorophyll a-b binding protein 22R, chloroplast precursor (LHCII type I CAB-22R
JMSF047K06Sequence662001804 (183)gb:AB012638_1511884e-101Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b713001804 (183)pir|S07942|CDKVe-129chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF047K09Sequence663001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)776001804 (183)pir|S07942|CDKVe-133chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF047O05Sequence706005144 (7)gb:AF284759_17830945e-63Pisum sativum TatC (tatC) mRNA, complete cds; nuclear gene for chloroplast produ751001804 (183)sp|P12329|CB21_MAIZEe-133Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF048E05Sequence663001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)775001804 (183)pir|S07942|CDKVe-136chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF048N05Sequence655001804 (183)gb:AB012638_1511884e-101Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b714001804 (183)pir|S07942|CDKVe-129chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF049A19Sequence637001804 (183)gb:AB012638_15118849e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b432001804 (183)gb:AF279250_17828036e-51Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, co
JMSF049I17Sequence655001804 (183)gb:AB012638_1511884e-101Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b748001804 (183)sp|P12329|CB21_MAIZEe-132Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF049M20Sequence183001804 (183)sp|P12329|CB21_MAIZE4e-18Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF051M12Sequence663001804 (183)pir|S07942|CDKVe-102chlorophyll a/b-binding protein precursor - cucumber (fragment)727001804 (183)pir|S07942|CDKVe-129chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF052A14Sequence646001804 (183)gb:AB012638_15118842e-98Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b788001804 (183)pir|S07942|CDKVe-123chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF052G19Sequence643001804 (183)gb:AB012638_15118843e-96Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b871001804 (183)pir|S07942|CDKVe-137chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF052J08Sequence643001804 (183)gb:AB012638_15118841e-97Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b910001804 (183)pir|S07942|CDKVe-140chlorophyll a/b-binding protein precursor - cucumber (fragment)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF028A13- C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
rJMSF049A19- AATGATAGCAATGAATCACAAATTTAAAACAAAAAGAAATGCAGCTGCAA
rJMFF028A13- AAAGGAAAGAAATGATAGCAATGAATCACAAATTTAAAACAAAAAGAAATGCAGCTGCAA
rJMSF052A14- ATGAATCACAAATTTAAAACAAAAAGAAATGCAGCTGCAA
rJMSF031N09- AATGCAGCTGC-A
rJMSF025M18- AATGCAGCTGCAA
JMFN018E22- GCAA
JMFS033C02+ GCAA
rJMFF042F03- GCTGAAA
JMFN030N08- GCAGCTGCAA
rJMFF010J11- TGCAGCTGCAA
rJMFF025H07- AAAAGAAATGCAGCTGCAA
rJMSF008L08- AATGATAGCAATGAATCACAAATTTAAAACAAAAAGAAATGCAGCTGCAA
rJMSF019J06- AAATGCAGCTGCAA
JMFN012K19+ GCAA
rJMSF052G19- AATGATAGCAATGAATCACAAATTTAAAACAAAAAGAAATGCAGCTGCAA
                      ____________________________________________________________
consensus AAAGGAAAGAAATGATAGCAATGAATCACAAATTTAAAACAAAAAGAAATGCAGCTGCAA
 
. : . : . : . : . : . :
rJMSF049A19- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF028A13- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF025F24- ATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF052A14- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACA-AAAAACACAT-G
rJMSF019G18- AACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF031N09- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF031L08- TATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF025M18- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF016M24- ATTAGATCAAACCACTTCAGCACATCACACAAAAACACAC-G
rJMSF022C13- GCACATCACACAAAAACACAT-G
rJMFF028H08- TTCAGCACATCACACAAAAACACAT-G
rJMSF033N19- GCACATCACACAAAAACACAT-G
rJMFF013M10- CAGCACATCACACAAAAACACAT-G
rJMSF037N01- GCACATCACACAAAAACACAT-G
rJMFF008N20- ACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF003I05- TTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF036K09- CTTCAGCACATCACACAAAAACACAT-G
rJMFF022B14- TTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF032A06- TATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
JMFN018E22- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
JMFS043B11+ ATTCACATATTATCCATTAGATCAATCCACCTCAGCACATCACTCAAAAACACAT-G
JMFS033C02+ AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF003C24- ACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF042F03- AGAATTCTCATATTATCCATTAAATCAAACCACTTCAGCACATCACAAAAAAACCCCT-G
JMFN030N08- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF010J11- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF025H07- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF008L08- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF019J06- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF030M20- AACACAT-G
rJMFF013M21- TG
JMFN012K19+ AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF052G19- AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF042F09- CACTTCAGCACATCACACAAAAACACAT-G
rJMSF041K21- GCACATCACACAAAAACACAT-G
rJMSF037H11- ATCACACAAAAACACAT-G
rJMSF046I16- GCACATCACACAAAAACACAT-G
rJMSF016H19- ACTTCAGCACATCACACAAAAACACAT-G
rJMSF048E05- CGCACATCACACAAAAACACAT-G
rJMSF026N16- CGCACATCACACAAAAACACAT-G
rJMSF016I18- GCACATCACACAAAAACACAT-G
rJMSF015P15- GCACATCACACAAAAACACATGG
rJMSF022D03- GCACATCACACAAAAACACATGG
rJMSF013D16- GCACATCACACAAAAACACATGG
rJMSF049I17- GCACATCACACAAAAACACAT-G
rJMSF043N04- ATCACACAAAAACACAT-G
rJMSF030P07- GCACATCACACAAAAACACAT-G
rJMSF002N06- GCACATCACACAAAAACACAT-G
rJMSF026O13- CGCACATCACACAAAAACACAT-G
rJMSF026M16- CGCACATCACACAAAAACACAT-G
rJMSF015N09- TCGCACATCACACAAAAACACAT-G
rJMSF026L18- CGCACATCACACAAAAACACAT-G
rJMSF047K09- TCGCACATCACACAAAAACACAT-G
rJMSF017O12- TCGCACATCACACAAAAACACAT-G
rJMSF001F06- GCACATCACACAAAAACACAT-G
rJMSF006H09- ATCACACAAAAACACATGN
rJMSF025M22- GCACATCACACAAAAACACATGG
rJMSF013K21- GCACATCACACAAAAACACAT-G
rJMSF034L09- GCACATCACACAAAAACACAT-G
rJMSF033N23- GCACATCACACAAAAACACAT-G
rJMSF007H09- TCGCACATCACACAAAAACACAT-G
rJMSF021J23- CACTTCAGCACATCACACAAAAACACAT-G
rJMFF016C15- CTTCAGCACATCACACAAAAACACAT-G
rJMSF007C22- ACTTCAGCACATCACACAAAAACACAT-G
rJMSF045H15- GCACATCACACAAAAACACAT-G
rJMSF047O05- TCGCACATCACACAAAAACACATGG
rJMSF051M12- AACCACTTCAGCACATCACACAAAAACACAT-G
rJMFF010E19- GCACATCACACAAAAACACAT-G
rJMSF048N05- TCGCACATCACACAAAAACACATGG
rJMSF043J21- GCACATCACACAAAAACACAT-G
rJMSF047K06- TCGCACATCACACAAAAACACATGG
rJMSF011M21- GCACATCACACAAAAACACATGG
rJMSF024I07- GCACATCACACAAAAACACATGG
rJMSF006O15- GCACATCACACANAAACACATGG
rJMSF040P20- AACCACTTCAGCACATCACACAAAAACACAT-G
rJMSF018D15- ATCACACAAAAACACAT-G
rJMSF039D13- GCACATCACACAAAAACACAT-G
rJMSF038E23- GCACATCACACAAAAACACATGG
rJMSF039O08- ACAAAAACACAT-G
rJMSF039H13- CACATCACACAAAAACACAT-G
                      ____________________________________________________________
consensus AGAATTCACATATTATCCATTAGATCAAACCACTTCAGCACATCACACAAAAACACAT-G
 
. : . : . : . : . : . :
rJMSF049A19- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF028A13- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF025F24- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF052A14- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF019G18- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF031N09- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF031L08- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF025M18- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF016M24- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF022C13- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF028H08- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF033N19- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF013M10- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF037N01- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF008N20- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF003I05- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF036K09- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF022B14- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF032A06- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
JMFN018E22- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
JMFS043B11+ CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
JMFS033C02+ CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF003C24- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF042F03- CCCTAACTCTTCTG-TTCCTATTCACTTTACGGAAACTAATTTTGTGGCATAAGCCCATG
JMFN030N08- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF010J11- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF025H07- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF008L08- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF019J06- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF030M20- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCANG
rJMFF013M21- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATANGCCCAGG
JMFN012K19+ CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF052G19- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF042F09- CACTAACTCTACTG-TTCATATTCATTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF041K21- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF037H11- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF046I16- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF016H19- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF048E05- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF026N16- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF016I18- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF015P15- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF022D03- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF013D16- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF049I17- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF043N04- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF030P07- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF002N06- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF026O13- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF026M16- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF015N09- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF026L18- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF047K09- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF017O12- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF001F06- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF006H09- CACTAACTCTACTGNTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF025M22- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF013K21- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF002F06- ACTCTACTGNTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCANAGGCCCANG
rJMSF034L09- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF033N23- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF007H09- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF021J23- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF016C15- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF007C22- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF045H15- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF047O05- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF051M12- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMFF010E19- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF048N05- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF043J21- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF047K06- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF049M20- TTTCCGGGAACGAAGTTTGTGGAATANGCCCAGG
rJMSF011M21- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF024I07- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF006O15- CACTAACTCTACTGGTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF040P20- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF052J08- ATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF018D15- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF039D13- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF038E23- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF039O08- CACTAACTCTACTGTTTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
rJMSF039H13- CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
                      ____________________________________________________________
consensus CACTAACTCTACTG-TTCATATTCACTTTCCGGGAACGAAGTTTGTGGCATAGGCCCAGG
 
. : . : . : . : . : . :
rJMSF049A19- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF028A13- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF025F24- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF052A14- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF019G18- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF031N09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF031L08- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF025M18- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF016M24- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF022C13- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF028H08- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF033N19- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF013M10- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF037N01- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF008N20- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF003I05- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF036K09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF022B14- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF032A06- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
JMFN018E22- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
JMFS043B11+ CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
JMFS033C02+ CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF003C24- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF042F03- CTTTTTTGTTAACTGGGTCGGCGAGGTGG-GCGGCGAGGTTCTCCAATGGGCCCTTT-CC
JMFN030N08- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF010J11- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF025H07- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF008L08- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF019J06- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF030M20- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF013M21- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF037A05- TGGGTCGGCAANGTGG-TCNGCGAGGTTCTCCAATGGGCCCTTT-CC
JMFN012K19+ CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF052G19- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF042F09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF041K21- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF037H11- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF046I16- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF016H19- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF048E05- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF026N16- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF016I18- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF015P15- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF022D03- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF013D16- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF049I17- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF043N04- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF030P07- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF002N06- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF026O13- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF026M16- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF015N09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF026L18- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF047K09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF017O12- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF001F06- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF006H09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF025M22- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF013K21- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF002F06- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF034L09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF033N23- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF007H09- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF021J23- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF016C15- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF007C22- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF045H15- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF047O05- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF051M12- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMFF010E19- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF048N05- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF043J21- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF047K06- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF049M20- NGTTGTTGTTAACTGGGTCGGCAAGGTGGATCGGCGAGGTTCTCCAATGGGNCCTTT-CC
rJMSF011M21- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF024I07- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF006O15- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGNGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF040P20- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF052J08- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF018D15- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF039D13- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF038E23- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF039O08- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
rJMSF039H13- CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
JMSF043N04+ TCCAATGGGCCCTTT-CC
JMSF043J21+ TCTCCAATGGGCCCTTT-CC
JMSF041K21+ TCCAATGGGCCCTTTNCC
rJMSF043B16- GCCCTTT-CC
JMFN006D08+ TCCAATGGGCCCTTT-CC
JMFN009D05+ TCCAATGGGCCCTTT-CC
JMSF046I16+ TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
                      ____________________________________________________________
consensus CGTTGTTGTTAACTGGGTCGGCAAGGTGG-TCGGCGAGGTTCTCCAATGGGCCCTTT-CC
 
. : . : . : . : . : . :
rJMSF049A19- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF028A13- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF025F24- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF052A14- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF019G18- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTATT
rJMSF031N09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF031L08- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF025M18- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF016M24- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF022C13- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF028H08- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF033N19- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF013M10- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF037N01- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF008N20- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF003I05- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF036K09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF022B14- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF032A06- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMFN018E22- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMFS043B11+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMFS033C02+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF003C24- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF042F03- CGAAACGATGGCCTAAAAAAACAATCCGAACTTGGATAACATGGCAGGCCTGCCATTCTT
JMFN030N08- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF010J11- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF025H07- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF008L08- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF019J06- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF030M20- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF013M21- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF037A05- NGTAACNATGGCCTGAACGAANAATCCTAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMFN012K19+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF052G19- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF042F09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF041K21- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF037H11- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF046I16- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF016H19- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF048E05- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF026N16- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF016I18- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF015P15- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF022D03- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF013D16- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF049I17- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF043N04- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF030P07- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF002N06- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF026O13- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF026M16- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF015N09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF026L18- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF047K09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF017O12- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF001F06- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF006H09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF025M22- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF013K21- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF002F06- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF034L09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF033N23- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF007H09- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF021J23- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF016C15- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF007C22- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF045H15- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF047O05- GGTAACAATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF051M12- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMFF010E19- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF048N05- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF043J21- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF047K06- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF049M20- GGTAACAATGGNCTGAACGAANAATCCGAACATGGAGAACATGGCAAGTCTGNCATTCTT
rJMSF011M21- GGTAACAATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF024I07- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF006O15- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF040P20- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF052J08- GGTAACAATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF018D15- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF039D13- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF038E23- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF039O08- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF039H13- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMSF043N04+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMSF043J21+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMSF041K21+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
rJMSF043B16- GGTAACGATGGCCTGAACGAAGAATCCGAACATGGANAACATGGCAAGTCTGCCATTCTT
JMFN006D08+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMFN009D05+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMSF046I16+ GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
JMSF042F09+ TTCTT
                      ____________________________________________________________
consensus GGTAACGATGGCCTGAACGAAGAATCCGAACATGGAGAACATGGCAAGTCTGCCATTCTT
 
. : . : . : . : . : . :
rJMSF049A19- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF028A13- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF025F24- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF052A14- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF019G18- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF031N09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF031L08- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF025M18- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF016M24- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF022C13- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF028H08- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF033N19- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF013M10- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF037N01- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF008N20- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF003I05- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF036K09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF022B14- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF032A06- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMFN018E22- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMFS043B11+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCTTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMFS033C02+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF003C24- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF042F03- GATCTCCTTCAACTTGAGCTCAAGCAAAGCCTCTGGGACCTCAACCAAACCCAATGGGTC
JMFN030N08- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF010J11- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF025H07- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF008L08- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF019J06- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF030M20- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGNC
rJMFF013M21- GANCTCCTTCACCTTGANCTCGGCGAAAGCCTCTGGGTCGTCANCGANACCCAATGGGTC
rJMFF037A05- GAGCTCCTTCACCTTNAGCTCGGCNAAAGCCTCTGGGTCGTCAGCGAGACCCAATGNGTC
JMFN012K19+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF052G19- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF042F09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF041K21- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF037H11- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF046I16- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF016H19- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF048E05- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF026N16- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF016I18- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF015P15- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF022D03- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF013D16- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF049I17- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF043N04- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF030P07- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF002N06- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF026O13- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF026M16- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF015N09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF026L18- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF047K09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF017O12- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF001F06- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF006H09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF025M22- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF013K21- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF002F06- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF034L09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF033N23- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF007H09- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF021J23- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF016C15- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF007C22- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF045H15- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF047O05- GAGCTCCTTGACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF051M12- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMFF010E19- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF048N05- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF043J21- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF047K06- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF049M20- GAGCTCCTTGACCTTGA
rJMSF011M21- GAGCTCCTTGACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF024I07- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF006O15- GAGCTCCTTCACCTTGAGCTCGGCNAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF040P20- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF052J08- GAGCTCCTTGACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF018D15- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF039D13- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF038E23- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF039O08- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
rJMSF039H13- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF043N04+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF043J21+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF041K21+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF026N16+ CGTCAGCGAGACCCAATGGGTC
JMSF048N05+ TCAGCGAGACCCAATGGGTC
JMSF049I17+ TCAGCGAGACCCAATGGGTC
JMSF030P07+ GTC
JMSF049A19+ TC
JMSF039O08+ C
JMFS115H10+ GGTC
JMFN008G20+ AATGGGTC
JMSF022D03+ GTCAGCGAGACCCAATGGGTC
JMSF039D13+ TCAGCGAGACCCAATGGGTC
JMSF025M22+ TC
JMSF026L18+ TC
JMSF039H13+ C
JMFS102E07+ C
rJMSF043B16- GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCNGCGAGACCCAATGGGTC
JMFN006D08+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMFN009D05+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF046I16+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF045H15+ AGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF047K09+ CGTCAGCGAGACCCAATGGGTC
JMSF038E23+ TCGTCAGCGAGACCCAATGGGTC
JMFN013E02+ GTCAGCGAGACCCAATGGGTC
JMFN005C09+ CAGCGAGACCCAATGGGTC
JMFN011L18+ GACCCAATGGGTC
JMFN006P06+ GTCAGCGAGACCCAATGGGTC
JMSF042F09+ GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
JMSF048E05+ GTCAGCGAGACCCAATGGGTC
JMSF037H11+ GTCAGCGAGACCCAATGGGTC
JMSF047K06+ TCAGCGAGACCCAATGGGTC
JMSF051M12+ GTCAGCGAGACCCAATGGGTC
JMSF034L09+ GTC
JMSF052J08+ TC
JMSF037N01+ TC
JMSF033N23+ C
JMSF052G19+ TC
JMSF022C13+ TC
JMSF026O13+ TC
JMFN010O04+ GTC
JMFS061G02+ GTC
JMSF033N19+ GTCAGCGAGACCCAATGGGTC
JMSF024I07+ C
JMSF052A14+ GTC
JMFF042F03+ C
                      ____________________________________________________________
consensus GAGCTCCTTCACCTTGAGCTCGGCGAAAGCCTCTGGGTCGTCAGCGAGACCCAATGGGTC
 
. : . : . : . : . : . :
rJMSF049A19- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCNGAGGGGTCCGCCGGCAATAC
rJMFF028A13- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF025F24- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF052A14- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF019G18- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF031N09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF031L08- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF025M18- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF016M24- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF022C13- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF028H08- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF033N19- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF013M10- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF037N01- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF008N20- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF003I05- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF036K09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF022B14- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF032A06- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN018E22- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS043B11+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS033C02+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF003C24- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGATGGGTCCGCCGGCAATAC
rJMFF042F03- -TAACCTCCCCCCGGAGTAGAGTGGGTCTGTGATCTCTCCGAGGGCCCCGCCGACAATAA
JMFN030N08- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF010J11- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF025H07- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF008L08- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF019J06- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF030M20- -GAANCTGCCNCCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAN
rJMFF013M21- -GAAGCTGCCACCGGGGTANAGTGGGTCNGTGATCTCTCCGAGGGGTNCGCCGGNAATAC
rJMFF037A05- AGAAGCTGCCACCGGGGTAGAGNGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGNAATAC
JMFN012K19+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF052G19- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF042F09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF041K21- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF037H11- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF046I16- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF016H19- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF048E05- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF026N16- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF016I18- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF015P15- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF022D03- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF013D16- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF049I17- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF043N04- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF030P07- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF002N06- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF026O13- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF026M16- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF015N09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF026L18- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF047K09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF017O12- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF001F06- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF006H09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF025M22- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF013K21- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF002F06- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF034L09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF033N23- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF007H09- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF021J23- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF016C15- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF007C22- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF045H15- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF047O05- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF051M12- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMFF010E19- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF048N05- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF043J21- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF047K06- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF011M21- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF024I07- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF006O15- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF040P20- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF052J08- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF018D15- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF039D13- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF038E23- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF039O08- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF039H13- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF043N04+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF043J21+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF041K21+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF026N16+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF048N05+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF049I17+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF030P07+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF049A19+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF039O08+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN017L08+ GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS115H10+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS099B07+ CGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN018P05+ GGGGTCCGCCGGCAATAC
JMFN017P04+ GAGGGGTCCGCCGGCAATAC
JMFN008G20+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN030A02+ TCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF022D03+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF039D13+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF025M22+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF026L18+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF039H13+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS102E07+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
rJMSF043B16- -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN006D08+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN009D05+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS088A03+ CGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF019J06+ TCCGAGGGGTCCGCCGGCAATAC
JMSF046I16+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF045H15+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF047K09+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF038E23+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN013E02+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN005C09+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN011L18+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS048D04+ TCCGAGGGGTCCGCCGGCAATAC
JMFN006P06+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF042F09+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF048E05+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF037H11+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF047K06+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF051M12+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF034L09+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF052J08+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF037N01+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF033N23+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF052G19+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF022C13+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF026O13+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN014I15+ CCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN037E19+ CGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFN010O04+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFS061G02+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF040P20+ CCGAGGGGTCCGCCGGCAATAC
JMSF033N19+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF024I07+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMSF052A14+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
JMFF042F03+ -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
                      ____________________________________________________________
consensus -GAAGCTGCCACCGGGGTAGAGTGGGTCGGTGATCTCTCCGAGGGGTCCGCCGGCAATAC
 
. : . : . : . : . : . :
rJMSF049A19- GGTAACCCTCANCGGCTCCCATCAAC
rJMFF028A13- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF025F24- GGTAACCCTCAACGGCTCTCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF052A14- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF019G18- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF031N09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF031L08- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF025M18- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF016M24- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF022C13- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF028H08- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF033N19- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF013M10- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF037N01- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF008N20- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF003I05- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF036K09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF022B14- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF032A06- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN018E22- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS043B11+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS033C02+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF003C24- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF042F03- GGTAACCCTCATCCGCTCCCATCAACACGACTT-GGCATGACCAC-ATGGACGATATGCT
JMFN030N08- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF010J11- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF025H07- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF008L08- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF019J06- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF030M20- GGTANCCCTCNACGGCTCCCATCAACACATCTT-GGNATGCCCAN-ATGGCCNAGATGCT
rJMFF013M21- GGTAACCCTCAACGGCTCCCATCAACACA
rJMFF037A05- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAN-ATGGCCAAGATGCT
JMFN012K19+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF052G19- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF042F09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF041K21- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF037H11- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF046I16- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGTATGCCCAG-ATGGCCAAGATGCT
rJMSF016H19- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF048E05- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF026N16- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF016I18- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF015P15- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF022D03- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF013D16- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF049I17- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF043N04- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF030P07- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF002N06- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF026O13- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF026M16- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF015N09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF026L18- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF047K09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF017O12- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF001F06- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF006H09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF025M22- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF013K21- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF002F06- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF034L09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF033N23- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF007H09- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF021J23- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF016C15- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF007C22- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF045H15- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF047O05- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF051M12- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMFF010E19- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF048N05- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF043J21- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF047K06- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF011M21- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF024I07- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGTATGCCCAG-ATGGCCAAGATGCT
rJMSF006O15- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAANATGCT
rJMSF040P20- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF052J08- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF018D15- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF039D13- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF038E23- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF039O08- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF039H13- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF043N04+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF043J21+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF041K21+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF026N16+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF048N05+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF049I17+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF030P07+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF049A19+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF039O08+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN017L08+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS115H10+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS099B07+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN018P05+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN017P04+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS103C08+ AACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN008G20+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN030A02+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF006H11- CTCCCATCNACACAACTT-GGCATGCCCAGNATGGCCAAGATGCT
JMFF036K09+ ACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFF008N20+ ATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFF010E19+ CCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFF028H08+ CAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFF022B14+ CCATCAACACAACTTGGGCATGCCCAG-ATGGCCAAGATGCT
JMSF022D03+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF039D13+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF025M22+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF026L18+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF039H13+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS102E07+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
rJMSF043B16- GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGNATGCCCAN-ATGGCCAAGATGCT
JMFN006D08+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN009D05+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAAATGCT
JMFS088A03+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF019J06+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFF032A06+ AACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFF016M24+ ACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF046I16+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGTATGCCCAG-ATGGCCAAGATGCT
JMSF045H15+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF047K09+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF038E23+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN013E02+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN005C09+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN011L18+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS048D04+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN006P06+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF042F09+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF048E05+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF037H11+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF047K06+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF051M12+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF034L09+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF052J08+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF037N01+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF033N23+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF052G19+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF022C13+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF026O13+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN014I15+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN037E19+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN010O04+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFS061G02+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF040P20+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFN011K21+ CACAACTT-GGCATGCACAG-ATGGTCAAGATGCT
JMFF025F24+ CATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF033N19+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF024I07+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGTATGCCCAG-ATGGCCAAGATGCT
JMSF025H17+ CTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMSF052A14+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
JMFF042F03+ GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
                      ____________________________________________________________
consensus GGTAACCCTCAACGGCTCCCATCAACACAACTT-GGCATGCCCAG-ATGGCCAAGATGCT
 
. : . : . : . : . : . :
rJMFF028A13- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF025F24- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF052A14- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF019G18- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF031N09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF031L08- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF025M18- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF016M24- CTGTGTGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF022C13- CTGTGCGTGGATCAAGCTTGTGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF028H08- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF033N19- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF013M10- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF037N01- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF008N20- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF003I05- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF036K09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF022B14- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF032A06- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN018E22- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS043B11+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS033C02+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF003C24- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF042F03- CTGGGCGTGGATCAAGCTTGGGTTGCCCAAAAAGACCACACCCCCCTCACAGAAGATCTG
JMFN030N08- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF010J11- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF025H07- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF008L08- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF019J06- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAANATCTG
rJMFF030M20- CTGTGCGTGGATCAAGCTTGGGTTGCCCAANTANNCAANACCTCCCTCG
rJMFF037A05- CTGTGCGTGGATC
JMFN012K19+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATC
rJMSF052G19- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF042F09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF041K21- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF037H11- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF046I16- CTGTGCGT-GATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF016H19- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF048E05- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF026N16- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF016I18- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF015P15- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF022D03- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF013D16- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF049I17- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF043N04- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF030P07- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF002N06- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF026O13- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF026M16- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF015N09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF026L18- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF047K09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF017O12- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF001F06- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF006H09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF025M22- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF013K21- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF002F06- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF034L09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF033N23- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF007H09- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF021J23- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF016C15- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF007C22- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF045H15- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF047O05- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF051M12- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMFF010E19- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF048N05- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF043J21- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF047K06- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF011M21- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF024I07- CTGTGCGT-GATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF006O15- CTGTGCGT
rJMSF040P20- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF052J08- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF018D15- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF039D13- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF038E23- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF039O08- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF039H13- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF043N04+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF043J21+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF041K21+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF026N16+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF048N05+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF049I17+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF030P07+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF049A19+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF039O08+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN017L08+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS115H10+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS099B07+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN018P05+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN017P04+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS103C08+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN008G20+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN030A02+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF006H11- CTNTGCGTGGATCAAGCTTGGGTTGCCCAAGTANTCAAGACCTCCCTCGCTGAANATCTG
JMFF036K09+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS158G06+ GATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF008N20+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF010E19+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF028H08+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF022B14+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF028A13+ GCTGAAGATCTG
JMFF031L08+ TCTG
JMSF022D03+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF039D13+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF025M22+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF026L18+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF039H13+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS102E07+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
rJMSF043B16- CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN006D08+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN009D05+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS088A03+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF019J06+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF032A06+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF018D15+ G
JMFF016M24+ CTGTGTGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN016K18+ G
JMSF046I16+ CTGTGCGT-GATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF045H15+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF047K09+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF038E23+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN013E02+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN005C09+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN011L18+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS048D04+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN006P06+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF042F09+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF048E05+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF037H11+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF047K06+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF051M12+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF034L09+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF052J08+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF037N01+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF033N23+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF025H07+ CGCTGAAGATCTG
JMSF052G19+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF003I05+ GCTGAAGATCTG
JMSF022C13+ CTGTGCGTGGATCAAGCTTGTGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF026O13+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN014I15+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN037E19+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN010O04+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFS061G02+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF040P20+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFN011K21+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF025F24+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF033N19+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF016C15+ CGCTGAAGATCTG
JMSF024I07+ CTGTGCGT-GATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMSF025H17+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATNTG
JMSF016I18+ G
JMSF052A14+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
JMFF042F03+ CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
                      ____________________________________________________________
consensus CTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGACCTCCCTCGCTGAAGATCTG
 
. : . : . : . : . : . :
rJMFF028A13- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF025F24- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF052A14- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF019G18- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF031N09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF031L08- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF025M18- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF016M24- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF022C13- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF028H08- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF033N19- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF013M10- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF037N01- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF008N20- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF003I05- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF036K09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF022B14- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF032A06- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN018E22- AGCTACGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS043B11+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS033C02+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF003C24- AGCTCCGGCCTTGAACCACACTGCCTCG
rJMFF042F03- AGCTCCGGACTT-AACCACACTGCCTC
JMFN030N08- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGG
rJMFF010J11- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF025H07- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF008L08- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF019J06- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF052G19- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF042F09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF041K21- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF037H11- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF046I16- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF016H19- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF048E05- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF026N16- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF016I18- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF015P15- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF022D03- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF013D16- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF049I17- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF043N04- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF030P07- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF002N06- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF026O13- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF026M16- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF015N09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF026L18- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF047K09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF017O12- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF001F06- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF006H09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF025M22- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF013K21- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF002F06- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF034L09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF033N23- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF007H09- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF021J23- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF016C15- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF007C22- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF045H15- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF047O05- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF051M12- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMFF010E19- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF048N05- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF043J21- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF047K06- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF011M21- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF024I07- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF040P20- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF052J08- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF018D15- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF039D13- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF038E23- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF039O08- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF039H13- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF043N04+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF043J21+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF041K21+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF026N16+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF048N05+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF049I17+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF030P07+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF049A19+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF039O08+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN017L08+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS115H10+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS099B07+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN018P05+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN017P04+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS103C08+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN008G20+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN030A02+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF006H11- AGCTCCGGNCTTGAACCACACTGCCTCGCCGAACTTCACGCCG
JMFF036K09+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS158G06+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF017O12+ TCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF019G18+ TTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF008N20+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF010E19+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF028H08+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF022B14+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF028A13+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF031L08+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF022D03+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF039D13+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF025M22+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF026L18+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF039H13+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS102E07+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
rJMSF043B16- AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN006D08+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN009D05+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS088A03+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF019J06+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF032A06+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF018D15+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF015P15+ CTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF013D16+ CGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF015N09+ CTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF008F17+ ACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF016M24+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN016K18+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF046I16+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF045H15+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF047K09+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF038E23+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN013E02+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN005C09+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN011L18+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS048D04+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN006P06+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF042F09+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF048E05+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF037H11+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF047K06+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF051M12+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF034L09+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF052J08+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF037N01+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF033N23+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF025H07+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF052G19+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF003I05+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF022C13+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF026O13+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN014I15+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN037E19+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN010O04+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFS061G02+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF040P20+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFN011K21+ AGCTCCGGCCTTGAAACACGGTGCCTCGCCGAACTTCACGCCGTTGCGGGTCATCAGCTC
JMFF025F24+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF033N19+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF006H09+ TCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF016C15+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF024I07+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF025H17+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF013M10+ GCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF016I18+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF013M07+ CCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF010J11+ GAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF001F06+ GGCCTTGAACCACANTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF002F06+ CACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMSF052A14+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
JMFF042F03+ AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
                      ____________________________________________________________
consensus AGCTCCGGCCTTGAACCACACTGCCTCGCCGAACTTCACGCCGTTGCGGGACAACAGCTC
 
. : . : . : . : . : . :
rJMFF028A13- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF025F24- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF052A14- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF019G18- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF031N09- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF031L08- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF025M18- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF016M24- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF022C13- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF028H08- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF033N19- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF013M10- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF037N01- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF008N20- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF003I05- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF036K09- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF022B14- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF032A06- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN018E22- CGGGAAAACGCATCCAAGGGCTCCC
JMFS043B11+ CGGGAAAACGCATCCAAG
JMFS033C02+ CGGGAAAACGCATCCAAG
rJMFF010J11- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF025H07- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF008L08- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF019J06- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF052G19- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF042F09- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF041K21- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF037H11- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF046I16- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF016H19- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF048E05- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF026N16- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF016I18- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF015P15- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF022D03- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF013D16- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF049I17- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF043N04- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF030P07- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF002N06- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF026O13- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF026M16- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF015N09- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF026L18- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF047K09- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF017O12- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF001F06- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF006H09- CNGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF025M22- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF013K21- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF002F06- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF034L09- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF033N23- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF007H09- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF021J23- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF016C15- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCTCCCAGCT
rJMSF007C22- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF045H15- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF047O05- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF051M12- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMFF010E19- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF048N05- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF043J21- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF047K06- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF011M21- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF024I07- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF040P20- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF052J08- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF018D15- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF039D13- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF038E23- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF039O08- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF039H13- CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF043N04+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF043J21+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF041K21+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF026N16+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF048N05+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF049I17+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF030P07+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF049A19+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF039O08+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN017L08+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS115H10+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS099B07+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN018P05+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN017P04+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS103C08+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN008G20+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN030A02+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF036K09+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS158G06+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF017O12+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF019G18+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF008N20+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF010E19+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF028H08+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF022B14+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF028A13+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF031L08+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF022D03+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF039D13+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF025M22+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF026L18+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF039H13+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS102E07+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
rJMSF043B16- CGGGAAAACGCATCCNAGGGCT
JMFN006D08+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN009D05+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS088A03+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF019J06+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF032A06+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF018D15+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF015P15+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF013D16+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF015N09+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF008F17+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF008L08+ CT-CCAGCT
JMFF016M24+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN016K18+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF046I16+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF045H15+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF047K09+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF038E23+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN013E02+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN005C09+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN011L18+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS048D04+ CGGGAAAACGCATACAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN006P06+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF042F09+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF048E05+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF037H11+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF047K06+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF051M12+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF034L09+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF052J08+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF037N01+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF033N23+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF025H07+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF052G19+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF003I05+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF022C13+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF026O13+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN014I15+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN037E19+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN010O04+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFS061G02+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF040P20+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFN011K21+ CGGGAAAACGCATCCAAGGGCTCCCAGCATGGCCCATTTGGAGTGGATCACCT-CCAGCT
JMFF025F24+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF033N19+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF006H09+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF016C15+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF007C22+ CACCT-CCAGCT
JMSF024I07+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF025H17+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF013M10+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF016I18+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF013M07+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF010J11+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF001F06+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF002F06+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMSF002N06+ CTGGAGTGGATCACCT-CCAGCT
JMSF052A14+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
JMFF042F03+ CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
                      ____________________________________________________________
consensus CGGGAAAACGCATCCAAGGGCTCCCAGCATCGCCCATCTGGAGTGGATCACCT-CCAGCT
 
. : . : . : . : . : . :
rJMFF028A13- CGCG
rJMFF025F24- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF052A14- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF019G18- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF031N09- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF031L08- --CGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF025M18- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF016M24- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF022C13- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF028H08- CGCGGTTCTTGGCGAANGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF033N19- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF013M10- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF037N01- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF008N20- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF003I05- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGANGCCAGCAGTGTCCCATCCGTAGT
rJMFF036K09- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF022B14- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF032A06- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF010J11- CGCGGTTCTTGGCGAANGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTA
rJMFF025H07- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAG
rJMSF008L08- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF019J06- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCANAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF052G19- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF042F09- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF041K21- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF037H11- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF046I16- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF016H19- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF048E05- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF026N16- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF016I18- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF015P15- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF022D03- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF013D16- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF049I17- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF043N04- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF030P07- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF002N06- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF026O13- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF026M16- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF015N09- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF026L18- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF047K09- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF017O12- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF001F06- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF006H09- CGCGGTTCTTGGCGAANGTCTCTGGGTCA
rJMSF025M22- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF013K21- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF002F06- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF034L09- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF033N23- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCANAGAGGCCAGCAGTGTCCCATCCGTAG
rJMSF007H09- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF021J23- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF016C15- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTANT
rJMSF007C22- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF045H15- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF047O05- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF051M12- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMFF010E19- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF048N05- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF043J21- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF047K06- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF011M21- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF024I07- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF040P20- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF052J08- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF018D15- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF039D13- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF038E23- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCACCCGTAGT
rJMSF039O08- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
rJMSF039H13- CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF043N04+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF043J21+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF041K21+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF026N16+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF048N05+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF049I17+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF030P07+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF049A19+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF039O08+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN017L08+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS115H10+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS099B07+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN018P05+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN017P04+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS103C08+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN008G20+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN030A02+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF036K09+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS158G06+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF017O12+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF019G18+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF008N20+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF010E19+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF028H08+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF022B14+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF028A13+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF031L08+ --CGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF022D03+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF039D13+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF025M22+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF026L18+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF039H13+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS102E07+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN006D08+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN009D05+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS088A03+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF019J06+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF032A06+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF018D15+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF015P15+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF013D16+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF015N09+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF008F17+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF008L08+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF006K24+ TCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF016M24+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN016K18+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF046I16+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF045H15+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF047K09+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF038E23+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCACCCGTAGT
JMFN013E02+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN005C09+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN011L18+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS048D04+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN006P06+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF042F09+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF048E05+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF037H11+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF047K06+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF051M12+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF034L09+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF052J08+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF037N01+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF033N23+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF025H07+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF052G19+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF003I05+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF022C13+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF026O13+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN014I15+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN037E19+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN010O04+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFS061G02+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF040P20+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFN011K21+ CGCGGTTCTTGGCGAAGGTGTTTGGGTCAGCAGAGAGGCCATCAGTGTCCCATCCGTAGT
JMFF025F24+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF033N19+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF006H09+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF016C15+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF007C22+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF024I07+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF025H17+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCNTCCGTAGT
JMFF013M10+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF016I18+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF013M07+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF010J11+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF001F06+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF002F06+ CGCGGTTCTTGGCGAAGGTCTNTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF002N06+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMSF052A14+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
JMFF042F03+ CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
                      ____________________________________________________________
consensus CGCGGTTCTTGGCGAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCATCCGTAGT
 
. : . : . : . : . : . :
rJMFF025F24- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGANAATGGACCCAAGTAC
rJMSF052A14- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF019G18- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF031N09- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMFF031L08- CGCCGGGGAACTCTCCGGTCAGGTAGCT
rJMSF025M18- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMFF016M24- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF022C13- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMFF028H08- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGANAATGGACCCAAGTAC
rJMSF033N19- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCG
rJMFF013M10- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF037N01- CGCCGGGGAACTCTCCGGTCAGGTAGCT
rJMFF008N20- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCGCCCGGAAAATGGACCCAAGTAC
rJMFF003I05- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CC
rJMFF036K09- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCG
rJMFF022B14- CGCCGGGGAACT
rJMFF032A06- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF008L08- CGCCGGGGAACTCTCCGGTCAGGTAG
rJMSF019J06- CGCCGGGGAACTCTCCGGTCAGGTAGC
rJMSF052G19- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF042F09- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF041K21- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAAAATGGACCCAAGTAC
rJMSF037H11- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF046I16- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF016H19- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF048E05- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF026N16- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF016I18- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF015P15- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF022D03- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF013D16- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF049I17- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF043N04- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF030P07- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF002N06- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF026O13- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF026M16- CGCCGGGGAACTCTCCGGTCANGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCA
rJMSF015N09- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF026L18- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF047K09- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF017O12- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF001F06- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF025M22- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF013K21- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF002F06- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF034L09- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF007H09- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF021J23- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMFF016C15- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGANAATGGACCCAAGTAC
rJMSF007C22- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF045H15- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF047O05- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF051M12- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMFF010E19- CGCCGGGGAACTCTCCGGCCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF048N05- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF043J21- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF047K06- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF011M21- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF024I07- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF040P20- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF052J08- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF018D15- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF039D13- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF038E23- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF039O08- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
rJMSF039H13- CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF043N04+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF043J21+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF041K21+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF026N16+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF048N05+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF049I17+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF030P07+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF049A19+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF039O08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN017L08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS115H10+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS099B07+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN018P05+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN017P04+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS103C08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN008G20+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN030A02+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF036K09+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS158G06+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF017O12+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF019G18+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF008N20+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF010E19+ CGCCGGGGAACTCTCCGGCCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF028H08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF022B14+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF028A13+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF031L08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF022D03+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF039D13+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF025M22+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF026L18+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF039H13+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS102E07+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN006D08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN009D05+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS088A03+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF019J06+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF032A06+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF018D15+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF015P15+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF013D16+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF015N09+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF008F17+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF008L08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF006K24+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF013K21+ AGGTAGCTNGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF016M24+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN016K18+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF046I16+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF045H15+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF047K09+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF038E23+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN013E02+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN005C09+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN011L18+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS048D04+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN006P06+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF042F09+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF048E05+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF037H11+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF047K06+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF051M12+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF034L09+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF052J08+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF037N01+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF033N23+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF025H07+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF052G19+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF003I05+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF022C13+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF026O13+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN014I15+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN037E19+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN010O04+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFS061G02+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF040P20+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFN011K21+ AGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGTAGAATGGACCCAAGTAC
JMFF025F24+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF033N19+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF006H09+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF016C15+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF007C22+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF024I07+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF025H17+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF013M10+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF016I18+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF013M07+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF010J11+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF011M21+ TCG-CCGGAGAATGGACCCAAGTAC
JMSF001F06+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF002F06+ CGCCGGGGAACTNTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF002N06+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF016H19+ AGGTAGCTNGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF006O13+ AGGTAGCTNGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMSF052A14+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
JMFF042F03+ CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
                      ____________________________________________________________
consensus CGCCGGGGAACTCTCCGGTCAGGTAGCTTGGGGGCTCG-CCGGAGAATGGACCCAAGTAC
 
. : . : . : . : . : . :
rJMFF025F24- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF052A14- TTAACACGGTCTGGGNCCGT-ACCATGGG-CTGCCGG-ATG
rJMSF019G18- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF031N09- TTAACACGGTCTGGG-CCGT-ACCA
rJMSF025M18- TTAACACGGTCTGGG-CCGT-ACCATGGG
rJMFF016M24- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-AT
rJMSF022C13- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAA
rJMFF028H08- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGA
rJMFF013M10- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCG
rJMFF008N20- TTAACA
rJMFF032A06- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAA
rJMSF052G19- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF042F09- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF041K21- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF037H11- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF046I16- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF016H19- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF048E05- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF026N16- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF016I18- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF015P15- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF022D03- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF013D16- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF049I17- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF043N04- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGGAATGAAACAG-GCTTCG-GCTTA
rJMSF030P07- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF002N06- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF026O13- TTAACACGGTCAGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF015N09- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF026L18- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF047K09- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF017O12- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF001F06- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGA-ACAG-GCTTCG-GCTTA
rJMSF025M22- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF013K21- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTNA
rJMSF002F06- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF034L09- TTAACACGGTCTGGG-CCGT-ACCATGGG-C
rJMSF007H09- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF021J23- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMFF016C15- TTAACACGGTCTGGG-CCGT-ACCATGGGCCTGCCGG-ATGAAACAG
rJMSF007C22- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF045H15- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF047O05- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGN-ATGAAACAG-GCTTCG-GCTTA
rJMSF051M12- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAA
rJMFF010E19- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACA
rJMSF048N05- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-A
rJMSF043J21- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCNGG-ATGAAA
rJMSF047K06- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-A
rJMSF011M21- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-AT
rJMSF024I07- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-A
rJMSF040P20- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF052J08- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF018D15- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF039D13- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF038E23- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF039O08- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
rJMSF039H13- TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF043N04+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF043J21+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF041K21+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF026N16+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF048N05+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF049I17+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF030P07+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF049A19+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF039O08+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN017L08+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS115H10+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS099B07+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN018P05+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN017P04+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS103C08+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN008G20+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN030A02+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF036K09+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS158G06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAGACAG-GCTTCG-GCTTA
JMSF017O12+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF019G18+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF008N20+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF010E19+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF028H08+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF022B14+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF028A13+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF031L08+ TTAACACGGTCTGGG-CCGT-A-CATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF022D03+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF039D13+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF025M22+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF026L18+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF039H13+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS102E07+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN006D08+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN009D05+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS088A03+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF019J06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF032A06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF018D15+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF015P15+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF013D16+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF015N09+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF008F17+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF008L08+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF006K24+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF013K21+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF012C24+ TCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF016M24+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN016K18+ TTAACACGGTCTGGG-CCGT-CCCCTCCC-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF046I16+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF045H15+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF047K09+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF038E23+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN013E02+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN005C09+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN011L18+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS048D04+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN006P06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF042F09+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF048E05+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF037H11+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF047K06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF051M12+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF034L09+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF052J08+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF037N01+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF033N23+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF025H07+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF052G19+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF003I05+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF022C13+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF026O13+ TTAACACGGTCAGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN014I15+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN037E19+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN010O04+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFS061G02+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF040P20+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFN011K21+ TTTACGCGGTGTGGG-CCGTGTCCATGGG-CTGCCGG-ATGAAACAGAGCTTCGTGCTTA
JMFF025F24+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF033N19+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF006H09+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF016C15+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF007C22+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF024I07+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF025H17+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF013M10+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF016I18+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF013M07+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF010J11+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF011M21+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF001F06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF002F06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF002N06+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF016H19+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF006O13+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMSF052A14+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
JMFF042F03+ TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
                      ____________________________________________________________
consensus TTAACACGGTCTGGG-CCGT-ACCATGGG-CTGCCGG-ATGAAACAG-GCTTCG-GCTTA
 
. : . : . : . : . : . :
rJMFF025F24- CCANCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGG
rJMSF019G18- CCAGCTGTCTTCCTCATGGTAAACTT-GG
rJMSF052G19- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGG
rJMSF042F09- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
rJMSF041K21- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCC
rJMSF037H11- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTT
rJMSF046I16- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCG
rJMSF016H19- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGG
rJMSF048E05- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCG
rJMSF026N16- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATT
rJMSF016I18- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATT
rJMSF015P15- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGT
rJMSF022D03- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGG
rJMSF013D16- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTC
rJMSF049I17- CNAGCTGTCTTCCTCATGGT
rJMSF043N04- CCAGCTGTCTTCCTCAT
rJMSF030P07- CNANCTGTCTT
rJMSF002N06- CCAGCTGTCTTCCTCATGGTAA
rJMSF026O13- CCAGCTGTCT
rJMSF015N09- CCAGCTGTCTTCCTCATGGTAAACTN-GGCGTTTCCGGTGATTT
rJMSF026L18- CCAGCTGTCTTCCTCATGGTAAACTN-GGCGTTTCCGGTGATT
rJMSF047K09- CCAGCTGTCTTCCTCATGGTAAACTTNGGCGTTTCCGGTGATTTCC
rJMSF017O12- CCAGCTGTCTTCCTCACGGTAAACTN-GGCGTTTCCGGTGA
rJMSF001F06- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATT
rJMSF025M22- CCAGCTGTCTTCCTCATGGTAAACTT-GG
rJMSF013K21- CCAGCTGTCTTCCTCATGG
rJMSF002F06- CCAGCTGTCTTCCTCAT
rJMSF007H09- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGA
rJMSF021J23- CCAGCTGTCTTCCTCATGGTA
rJMSF007C22- CCAGCTGTCTTCCTCATGGTA
rJMSF045H15- CNAGCTGTCTTCCTCATGGT
rJMSF047O05- CCAGCTGTCTTCCTCATGGT
rJMSF040P20- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
rJMSF052J08- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
rJMSF018D15- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
rJMSF039D13- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
rJMSF038E23- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
rJMSF039O08- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
rJMSF039H13- CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF043N04+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF043J21+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF041K21+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF026N16+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF048N05+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF049I17+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF030P07+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF049A19+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF039O08+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN017L08+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFS115H10+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFS099B07+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN018P05+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN017P04+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFS103C08+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN008G20+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN030A02+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF036K09+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFS158G06+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF017O12+ CCAGCTGTCTTCCTCACGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF019G18+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF008N20+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF010E19+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF028H08+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF022B14+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF028A13+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF031L08+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF022D03+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF039D13+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF025M22+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF026L18+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF039H13+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFS102E07+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN006D08+ CCAGC
JMFN009D05+ CCA
JMFS088A03+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF019J06+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF032A06+ CCAGCTGTCTTCCTCATGGTAAACCT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF018D15+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF015P15+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF013D16+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF015N09+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF008F17+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF008L08+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF006K24+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF013K21+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF012C24+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF016M24+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN016K18+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF046I16+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF045H15+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF047K09+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF038E23+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN013E02+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN005C09+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN011L18+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFS048D04+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN006P06+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF042F09+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF048E05+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF037H11+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF047K06+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF051M12+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF034L09+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF052J08+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF037N01+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF033N23+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF025H07+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF052G19+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF003I05+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF022C13+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF026O13+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN014I15+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN037E19+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN010O04+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFS061G02+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF040P20+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFN011K21+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF025F24+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF033N19+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF006H09+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF016C15+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF007C22+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF024I07+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF025H17+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF013M10+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF016I18+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF013M07+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF010J11+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF011M21+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF001F06+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF002F06+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF002N06+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF016H19+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF006O13+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMSF052A14+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
JMFF042F03+ CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
                      ____________________________________________________________
consensus CCAGCTGTCTTCCTCATGGTAAACTT-GGCGTTTCCGGTGATTTCCGGGGTGGAAGGCGA
 
. : . : . : . : . : . :
rJMSF042F09- GACCTTCACAGCC-TTTCCGGCA
rJMSF040P20- GACCTTCACAGCC-TTTCCGGCAAAAGAA
rJMSF052J08- GACCTTCACAGCC-TT
rJMSF018D15- GACCTTCACAGCC-TTT
rJMSF039D13- GACCTTCACAGCCTTTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTANAAGCAG-
rJMSF038E23- GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
rJMSF039O08- GACCTTCACAGCC-TTTCCGGCAAAAGAAG
rJMSF039H13- GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTANAAGCAG-
JMSF043N04+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF043J21+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF041K21+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF026N16+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF048N05+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF049I17+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF030P07+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF049A19+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF039O08+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN017L08+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS115H10+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS099B07+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN018P05+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN017P04+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS103C08+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN008G20+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN030A02+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAAG-TAGAAAGA-GCCATTGTAGAAGCAG-
JMFF036K09+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS158G06+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF017O12+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF019G18+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGAAG-
JMFF008N20+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF010E19+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF028H08+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF022B14+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF028A13+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF031L08+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF022D03+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF039D13+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF025M22+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF026L18+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF039H13+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS102E07+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS088A03+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF019J06+ GACCTTCACAGCC-TTTTCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF032A06+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF018D15+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF015P15+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF013D16+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF015N09+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF008F17+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF008L08+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF006K24+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF013K21+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF012C24+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF016M24+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN016K18+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF046I16+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF045H15+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF047K09+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF038E23+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN013E02+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN005C09+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN011L18+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS048D04+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN006P06+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF042F09+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF048E05+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF037H11+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF047K06+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF051M12+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF034L09+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF052J08+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF037N01+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF033N23+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF025H07+ GACCTTC-CAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF052G19+ GACCTT-ACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF003I05+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF022C13+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF026O13+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN014I15+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN037E19+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN010O04+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFS061G02+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF040P20+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFN011K21+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGGTAAGAAAGACGCCATTGTAGAAGCAGT
JMFF025F24+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF033N19+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF006H09+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF016C15+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF007C22+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF024I07+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF025H17+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF013M10+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF016I18+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF013M07+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF010J11+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF011M21+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF001F06+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF002F06+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF002N06+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF016H19+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF006O13+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMSF052A14+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
JMFF042F03+ GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
                      ____________________________________________________________
consensus GACCTTCACAGCC-TTTCCGGCAAAAGAAGAGG-AAGAAAGA-GCCATTGTAGAAGCAG-
 
. : . : . : . : . : . :
rJMSF039D13- CCATGTTTG
rJMSF038E23- CCATGTTTGTAAGAAGAAGAT
rJMSF039H13- CCATGTTTGTAAGAAGAAGATGAAGAANAAGAGAGTTTAATTTGTGGCTTC
JMSF043N04+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF043J21+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF041K21+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF026N16+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF048N05+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF049I17+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGC
JMSF030P07+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF049A19+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF039O08+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMFN017L08+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTG
JMFS115H10+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTA
JMFS099B07+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAG
JMFN018P05+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGA
JMFN017P04+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGA
JMFS103C08+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAG
JMFN008G20+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGA
JMFN030A02+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGT
JMFF036K09+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTT
JMFS158G06+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGA
JMSF017O12+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGC
JMSF019G18+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGC
JMFF008N20+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTT
JMFF010E19+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTT
JMFF028H08+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTG
JMFF022B14+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTG
JMFF028A13+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTT
JMFF031L08+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTT
JMSF022D03+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF039D13+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF025M22+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF026L18+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF039H13+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMFS102E07+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGA
JMFS088A03+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGA
JMSF019J06+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMFF032A06+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF018D15+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF015P15+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF013D16+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF015N09+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF008F17+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF008L08+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF006K24+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF013K21+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMSF012C24+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMFF016M24+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTC
JMFN016K18+ CCATG
JMSF046I16+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF045H15+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTTC
JMSF047K09+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTC
JMSF038E23+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTT
JMFN013E02+ CCATGTTTGTAAGAAGAAGATGAAGAAGAA
JMFN005C09+ CCATGTTTGTAAGAAGAAGATGAA
JMFN011L18+ CCATGTTTGTAAGAAGAAGATGAAGAAG
JMFS048D04+ CCATGTTTGTAAGAAGAAGATGAAGAA
JMFN006P06+ CCATGTTTGTAAGAAGAAGATGAAGAAG
JMSF042F09+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF048E05+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF037H11+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF047K06+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF051M12+ CCATGTTTGTAAGAAGAAGATGGAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTT
JMSF034L09+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF052J08+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTC
JMSF037N01+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTT
JMSF033N23+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTT
JMFF025H07+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTT
JMSF052G19+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMFF003I05+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTG
JMSF022C13+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCT
JMSF026O13+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCT
JMFN014I15+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAA
JMFN037E19+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTA
JMFN010O04+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAA
JMFS061G02+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAA
JMSF040P20+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMFN011K21+ CCATGTTTGTAAGAAGCAGATTAAGAA
JMFF025F24+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGA
JMSF033N19+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF006H09+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAG
JMFF016C15+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTT
JMSF007C22+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTC
JMSF024I07+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF025H17+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMFF013M10+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTG
JMSF016I18+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTTC
JMSF013M07+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTT
JMFF010J11+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTT
JMSF011M21+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTT
JMSF001F06+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTTC
JMSF002F06+ CCATGTTNGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTTC
JMSF002N06+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTT
JMSF016H19+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF006O13+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMSF052A14+ CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCC
JMFF042F03+ CCATG-TTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCCGG
                      ____________________________________________________________
consensus CCATGTTTGTAAGAAGAAGATGAAGAAGAAGAGAGTTTAATTTGTGGCTTGAGTTTCCGG