Previous Contig 001802:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016J08Sequence496001802 (3)pir|T00461|T004612e-32probable berberine bridge enzyme [imported] - Arabidopsis thaliana>gb:AC004238_1
JMFF042E13Sequence659001802 (3)pir|T00461|T004612e-49probable berberine bridge enzyme [imported] - Arabidopsis thaliana>gb:AC004238_1445010210 (2)gb:AY059832_15646762e-08Arabidopsis thaliana berberine bridge enzyme-like protein (At5g44390; K9L2.19) m
JMFF051J08Sequence499001802 (3)pir|T00461|T004619e-31probable berberine bridge enzyme [imported] - Arabidopsis thaliana>gb:AC004238_1384010210 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042E13+ TTATCAGCTCCGAGGCCGTACTTCCTCATCATGGTCCCATACGCGCCGCCGGTGATGTG
                      ____________________________________________________________
consensus TTATCAGCTCCGAGGCCGTACTTCCTCATCATGGTCCCATACGCGCCGCCGGTGATGTG
 
. : . : . : . : . : . :
JMFF042E13+ CCCGCCGATGCCCAGGCTGGTGCAGAGCCCCGCCGGGAAGCCGTGGGTGCGGCTCTGCTG
                      ____________________________________________________________
consensus CCCGCCGATGCCCAGGCTGGTGCAGAGCCCCGCCGGGAAGCCGTGGGTGCGGCTCTGCTG
 
. : . : . : . : . : . :
JMFF051J08+ GAGCCCACGCCGTGTTCTC
JMFF016J08+ TCGCCCCGGCCTGAGCCCACGCCGTGTTCTC
JMFF042E13+ AGAAATCCGGTAATACTCTTCTCCGACGGTCGCCCCGGCCTGAGCCCACGCCGTGTTCTC
                      ____________________________________________________________
consensus AGAAATCCGGTAATACTCTTCTCCGACGGTCGCCCCGGCCTGAGCCCACGCCGTGTTCTC
 
. : . : . : . : . : . :
JMFF051J08+ CTCCACGTTCACCTCTACCCTCCTCAGCTTCCCCAGATCAAGAATCACGAACGGCGAATC
JMFF016J08+ CTCCACGTTCACCTCTACCCTCCTCAGCTTCCCCAGATCAAGAATCACGAACGGCGAATC
JMFF042E13+ CTCCACGTTCACCTCTACCCTCCTCAGCTTCCCCAGATCAAGAATCACGAACGGCGAATC
                      ____________________________________________________________
consensus CTCCACGTTCACCTCTACCCTCCTCAGCTTCCCCAGATCAAGAATCACGAACGGCGAATC
 
. : . : . : . : . : . :
JMFF051J08+ CATCTCGGAGATATACGACAGGCATTCGTAATCATGGCCGCCGCTCCGGACTCTGAGCTG
JMFF016J08+ CATCTCGGAGATATACGACAGGCATTCGTAATCATGGCCGCCGCTCCGGACTCTGAGCTG
JMFF042E13+ CATCTCGGAGATATACGACAGGCATTCGTAATCATGGCCGCCGCTCCGGACTCTGAGCTG
                      ____________________________________________________________
consensus CATCTCGGAGATATACGACAGGCATTCGTAATCATGGCCGCCGCTCCGGACTCTGAGCTG
 
. : . : . : . : . : . :
JMFF051J08+ AACTCTGAGCTGCTTGGCGCAGATAACCGCCGCCTGGACGTGGGACTCAACCAATGGGGT
JMFF016J08+ AACTCTGAGCTGCTTGGCGCAGATAACCGCCGCCTGGACGTGGGACTCAACCAATGGGGT
JMFF042E13+ AACTCTGAGCTGCTTGGCGCAGATAACCGCCGCCTGGACGTGGGACTCAACCAATGGGGT
                      ____________________________________________________________
consensus AACTCTGAGCTGCTTGGCGCAGATAACCGCCGCCTGGACGTGGGACTCAACCAATGGGGT
 
. : . : . : . : . : . :
JMFF051J08+ GAAAATAAGTTTGGGTTTCGGGACAGACGGCACCAGACACCTCAGGTTCTGGGCCGTCGA
JMFF016J08+ GAAAATAAGTTTGGGTTTCGGGACAGACGGCACCAGACACCTCAGGTTCTGGGCCGTCGA
JMFF042E13+ GAAAATAAGTTTGGGTTTCGGGACAGACGGCACCAGACACCTCAGGTTCTGGGCCGTCGA
                      ____________________________________________________________
consensus GAAAATAAGTTTGGGTTTCGGGACAGACGGCACCAGACACCTCAGGTTCTGGGCCGTCGA
 
. : . : . : . : . : . :
JMFF051J08+ CTGGAGAATTGGAGTAAACGAAGCATTGTTCGGGGCGAAGAAGGCCGCCGAGAAGGGTAT
JMFF016J08+ CTGGAGAATTGGAGTAAACGAAGCATTGTTCGGGGCGAAGAAGGCCGCCGAGAAGGGTAT
JMFF042E13+ CTGGAGAATTGGAGTAAACGAAGCATTGTTCGGGGCGAAGAAGGCCGCCGAGAAGGGTAT
                      ____________________________________________________________
consensus CTGGAGAATTGGAGTAAACGAAGCATTGTTCGGGGCGAAGAAGGCCGCCGAGAAGGGTAT
 
. : . : . : . : . : . :
JMFF051J08+ GGTGAAGTCAGAGTTCGAACAAACACATTGGTAAAAACTTTCTTGGAATAATGAATCTGA
JMFF016J08+ GGTGAAGTCAGAGTTCGAACAAACACATTGGTAAAAACTTTCTTGGAATAATGAATCTGA
JMFF042E13+ GGTGAAGTCAGAGTTCGAACAAACACATTGGTAAAAACTTTCTTGGAATAATGAATCTGA
                      ____________________________________________________________
consensus GGTGAAGTCAGAGTTCGAACAAACACATTGGTAAAAACTTTCTTGGAATAATGAATCTGA
 
. : . : . : . : . : . :
JMFF051J08+ GAAAGCAAAGGAAGTTGATGATAAAGTGATGAGGATTGTGAGAATCCTTAGAAACCATGA
JMFF016J08+ GAAAGCAAAGGAAGTTGATGATAAAGTGATGAGGATTGTGAGAATCCTTAGAAACCATGA
JMFF042E13+ GAAAGCAAAGGAAGTTGATGATAAAGTGATGAGGATTGTGAGAATCCTTAGAAACCATGA
                      ____________________________________________________________
consensus GAAAGCAAAGGAAGTTGATGATAAAGTGATGAGGATTGTGAGAATCCTTAGAAACCATGA
 
. : . : . : . : . : . :
JMFF051J08+ GGAGTTTAAGGTTGCCATTTCTTTGGTTTTGGTTTTGGTTTTGGTGTGTTTTTTTTCAGA
JMFF016J08+ GGAGTTTAAGGTTGCCATTTCTTTGGTTTTGGTTTTGGTTTTGGT
JMFF042E13+ GGAGTTTAAGGTTGCCATTTCTTTGGTTTTGGTTTTGGTTTTGGTGTGTTTTTTTTCAGA
                      ____________________________________________________________
consensus GGAGTTTAAGGTTGCCATTTCTTTGGTTTTGGTTTTGGTTTTGGTGTGTTTTTTTTCAGA