Previous Contig 001799:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042C21Sequence650001799 (2)gb:AY136302_15818035e-64Arabidopsis thaliana putative protein (At4g32720) mRNA, complete cds.>gb:BT00039
JMFS168B11Sequence574001799 (2)gb:AY136302_15818031e-63Arabidopsis thaliana putative protein (At4g32720) mRNA, complete cds.>gb:BT00039

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS168B11+ ATAAACCAAGCTTTGCTTCAGAATACTTTGGGCATCTTCCTCACTAG
JMFF042C21+ TGCATAAACCAAGCTTTGCTTCAGAATACTTTGGGCATCTTCCTCACTAG
                      ____________________________________________________________
consensus TGCATAAACCAAGCTTTGCTTCAGAATACTTTGGGCATCTTCCTCACTAG
 
. : . : . : . : . : . :
JMFS168B11+ AAAATTCAACCAGGGCAGTGCCACAAAATAGCCTTTTGTCAGCAACATGGCGAGGTAGCC
JMFF042C21+ AAAATTCAACCAGGGCAGTGCCACAAAATAGCCTTTTGTCAGCAACATGGCGAGGTAGCC
                      ____________________________________________________________
consensus AAAATTCAACCAGGGCAGTGCCACAAAATAGCCTTTTGTCAGCAACATGGCGAGGTAGCC
 
. : . : . : . : . : . :
JMFS168B11+ TTACACTGTTAACCTTAGCATGTTGGCCAAAGAATGACTCAACATCTTCAAGCTTGACAT
JMFF042C21+ TTACACTGTTAACCTTAGCATGTTGGCCAAAGAATGACTCAACATCTTCAAGCTTGACAT
                      ____________________________________________________________
consensus TTACACTGTTAACCTTAGCATGTTGGCCAAAGAATGACTCAACATCTTCAAGCTTGACAT
 
. : . : . : . : . : . :
JMFS168B11+ CATACTCCAATGGAGATGCAGCTACTGTCCTCCCATCTAGTTGTTCTATAACCACCTCGG
JMFF042C21+ CATACTCCAATGGAGATGCAGCTACTGTCCTCCCATCTAGTTGTTCTATAACCACCTCGG
                      ____________________________________________________________
consensus CATACTCCAATGGAGATGCAGCTACTGTCCTCCCATCTAGTTGTTCTATAACCACCTCGG
 
. : . : . : . : . : . :
JMFS168B11+ GCTTTGGCAATTCTGTAGTTCTGCCAACTCTCTTTCCATCCTCTGAAATCTTGAGAAAAG
JMFF042C21+ GCTTTGGCAATTCTGTAGTTCTGCCCACTCTCTTTCCATCCTCTGAAATCTTGAGAAAAG
                      ____________________________________________________________
consensus GCTTTGGCAATTCTGTAGTTCTGCCCACTCTCTTTCCATCCTCTGAAATCTTGAGAAAAG
 
. : . : . : . : . : . :
JMFS168B11+ TCGAGCCCTTCAATGCATCCGCCACAGATTTCACTGTATCATCTGTTATATCCTCTGGCT
JMFF042C21+ TCGAGCCCTTCAATGCATCCGCCACAGATTTCACTGTATCATCTGTTATATCCTCTGGCT
                      ____________________________________________________________
consensus TCGAGCCCTTCAATGCATCCGCCACAGATTTCACTGTATCATCTGTTATATCCTCTGGCT
 
. : . : . : . : . : . :
JMFS168B11+ TTGCTGCTCCCAAACCCAGATGTGATCTCATCCTCGAAAACGAACATATCAAAGCCAAAC
JMFF042C21+ TTGCTGCTCCCAAACCCAGATGTGATCTCATCCTCGAAAACGAACATATCAAAGCCAAAC
                      ____________________________________________________________
consensus TTGCTGCTCCCAAACCCAGATGTGATCTCATCCTCGAAAACGAACATATCAAAGCCAAAC
 
. : . : . : . : . : . :
JMFS168B11+ ACACCAAGCCATCTTCACTTTCATCAACGGTTTTCTTAAGAAAAGAATCCCTAGGAAGAT
JMFF042C21+ ACACCAAGCCATCTTCACTTTCATCAACGGTTTTCTTAAGAAAAGAATCCCTAGGAAGAT
                      ____________________________________________________________
consensus ACACCAAGCCATCTTCACTTTCATCAACGGTTTTCTTAAGAAAAGAATCCCTAGGAAGAT
 
. : . : . : . : . : . :
JMFS168B11+ TGCTATCACTGAAGTAAAACTCAACCTGACGAATAACTTTCTTTGTGGTTTCCTCGTCCA
JMFF042C21+ TGCTATCACTGAAGTAAAACTCAACCTGACGAATAACTTTCTTTGTGGTTTCCTCGTCCA
                      ____________________________________________________________
consensus TGCTATCACTGAAGTAAAACTCAACCTGACGAATAACTTTCTTTGTGGTTTCCTCGTCCA
 
. : . : . : . : . : . :
JMFS168B11+ AAGGATTCGCCATTGTTGAGGGAAGGGAAGGAAAGGAGAAAGGGAGA
JMFF042C21+ AAGGATTCGCCATTGTTGAGGGAAGGGAAGGAAAGGAGAAAGGGAGAGCAGAGTCGGAGG
                      ____________________________________________________________
consensus AAGGATTCGCCATTGTTGAGGGAAGGGAAGGAAAGGAGAAAGGGAGAGCAGAGTCGGAGG
 
. : . : . : . : . : . :
JMFF042C21+ TTTAGGGTTACGAGGGAAGAGAGTGGTGGGTTTTAAGAAACAGTTAGGGATCCCACTCGG
                      ____________________________________________________________
consensus TTTAGGGTTACGAGGGAAGAGAGTGGTGGGTTTTAAGAAACAGTTAGGGATCCCACTCGG