Previous Contig 001791:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042A12Sequence565001791 (2)gb:AF302662_17843136e-18Arabidopsis thaliana ubiquitin-specific protease 8 (UBP8) mRNA, partial cds.565001791 (2)gb:AF302662_17843136e-18Arabidopsis thaliana ubiquitin-specific protease 8 (UBP8) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042A12+ TCATTATGGAAGCATGGGAGGAGGG
JMFF042A12- TCATTATGGAAGCATGGGAGGAGGG
                      ____________________________________________________________
consensus TCATTATGGAAGCATGGGAGGAGGG
 
. : . : . : . : . : . :
rJMFF042A12+ CACTACACTGCATTTGTTCGTCAAGGTGGTGAACAATGGTATGACTTTGACGACAGCCAT
JMFF042A12- CACTACACTGCATTTGTTCGTCAAGGTGGTGAACAATGGTATGACTTTGACGACAGCCAT
                      ____________________________________________________________
consensus CACTACACTGCATTTGTTCGTCAAGGTGGTGAACAATGGTATGACTTTGACGACAGCCAT
 
. : . : . : . : . : . :
rJMFF042A12+ GTTTCACCCGTCAGCGTGGAGAAGATAAAAACTTCAGCTGCCTATGTTCTGTTCTATAGA
JMFF042A12- GTTTCACCCGTCAGCGTGGAGAAGATAAAAACTTCAGCTGCCTATGTTCTGTTCTATAGA
                      ____________________________________________________________
consensus GTTTCACCCGTCAGCGTGGAGAAGATAAAAACTTCAGCTGCCTATGTTCTGTTCTATAGA
 
. : . : . : . : . : . :
rJMFF042A12+ AGAGTTGAAGAAAACGATATAGAAGAGATGAACAAGACCATCGTTAGGTGCTAGGGTACT
JMFF042A12- AGAGTTGAAGAAAACGATATAGAAGAGATGAACAAGACCATCGTTAGGTGCTAGGGTACT
                      ____________________________________________________________
consensus AGAGTTGAAGAAAACGATATAGAAGAGATGAACAAGACCATCGTTAGGTGCTAGGGTACT
 
. : . : . : . : . : . :
rJMFF042A12+ GAACAAGGCTTCACATTTATCCGCAAGTCTTGTAAAGAATCACATCTGTTGTGTTGTTCT
JMFF042A12- GAACAAGGCTTCACATTTATCCGCAAGTCTTGTAAAGAATCACATCTGTTGTGTTGTTCT
                      ____________________________________________________________
consensus GAACAAGGCTTCACATTTATCCGCAAGTCTTGTAAAGAATCACATCTGTTGTGTTGTTCT
 
. : . : . : . : . : . :
rJMFF042A12+ TTGGTGGCAGGCATATAGTTGGCAATTTTGGGGTCATCGCGGAAATGTTAGTGTGGCGAT
JMFF042A12- TTGGTGGCAGGCATATAGTTGGCAATTTTGGGGTCATCGCGGAAATGTTAGTGTGGCGAT
                      ____________________________________________________________
consensus TTGGTGGCAGGCATATAGTTGGCAATTTTGGGGTCATCGCGGAAATGTTAGTGTGGCGAT
 
. : . : . : . : . : . :
rJMFF042A12+ AAGGATAACCGTATAATACTTGAGAGTAGGGAACGACGGATGGTGAGGCGAAAGGGTTGA
JMFF042A12- AAGGATAACCGTATAATACTTGAGAGTAGGGAACGACGGATGGTGAGGCGAAAGGGTTGA
                      ____________________________________________________________
consensus AAGGATAACCGTATAATACTTGAGAGTAGGGAACGACGGATGGTGAGGCGAAAGGGTTGA
 
. : . : . : . : . : . :
rJMFF042A12+ TACAACGCGGGAAAAGTCTTACATCTATAACAAATTCTTTGTGATACAAGACCCAAGTTT
JMFF042A12- TACAACGCGGGAAAAGTCTTACATCTATAACAAATTCTTTGTGATACAAGACCCAAGTTT
                      ____________________________________________________________
consensus TACAACGCGGGAAAAGTCTTACATCTATAACAAATTCTTTGTGATACAAGACCCAAGTTT
 
. : . : . : . : . : . :
rJMFF042A12+ TTTGCTTGATTACCTAACAGGAAAGAAGAAGAAGCTAAGGGTAGCTTGAAATAGATTGCA
JMFF042A12- TTTGCTTGATTACCTAACAGGAAAGAAGAAGAAGCTAAGGGTAGCTTGAAATAGATTGCA
                      ____________________________________________________________
consensus TTTGCTTGATTACCTAACAGGAAAGAAGAAGAAGCTAAGGGTAGCTTGAAATAGATTGCA
 
. : . : . : . : . : . :
rJMFF042A12+ TAGTGCACATGTAAAATATTCTCTAAAATTCTTTATAGCAATTGTACTAATTACAACATT
JMFF042A12- TAGTGCACATGTAAAATATTCTCTAAAATTCTTTATAGCAATTGTACTAATTACAACATT
                      ____________________________________________________________
consensus TAGTGCACATGTAAAATATTCTCTAAAATTCTTTATAGCAATTGTACTAATTACAACATT