Previous Contig 001774:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008D07Sequence560001774 (14)pir|S18826|S188262e-72malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone
JMFF008L21Sequence591001774 (14)pir|S18826|S188265e-78malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone768010157 (19)pir|T06402|T064024e-71malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) 2, cyt
JMFF013H10Sequence566001774 (14)pir|S18826|S188269e-75malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone728010157 (19)pir|T06402|T064028e-68malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) 2, cyt
JMFF022A21Sequence486001774 (14)pir|S18826|S188266e-58malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone784010157 (19)pir|T06402|T064029e-73malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) 2, cyt
JMFF038P04Sequence596001774 (14)pir|S18826|S188265e-80malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone717010157 (19)pir|T06402|T064021e-64malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) 2, cyt
JMFF041L15Sequence658001774 (14)pir|S18826|S188261e-70malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone629010157 (19)gb:AB061256_15220177e-47Solanum tuberosum mRNA for NADP-dependent malic enzyme, partial cds.
JMFF047B02Sequence584001774 (14)pir|S18826|S188267e-86malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone396010157 (19)gb:AY271262_15941628e-08Zea mays NADP-malic enzyme mRNA, complete cds; nuclear gene for chloroplast prod
JMFS017C08Sequence627001774 (14)pir|S18826|S188264e-89malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone
JMFS065H04Sequence619001774 (14)pir|S18826|S188264e-85malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone
JMFS074E02Sequence607001774 (14)pir|S18826|S188264e-85malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone
JMFS116B09Sequence562001774 (14)pir|S18826|S188269e-77malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone
JMSF015D08Sequence513001774 (14)pir|S18826|S188261e-63malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone778010157 (19)pir|T06402|T064022e-77malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) 2, cyt
JMSF041M14Sequence799001774 (14)pir|S18826|S188267e-97malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone460010157 (19)gb:AB061256_15220172e-25Solanum tuberosum mRNA for NADP-dependent malic enzyme, partial cds.
JMSF048I24Sequence682001774 (14)pir|S18826|S188266e-96malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) (clone742010157 (19)pir|T06402|T064021e-72malate dehydrogenase (oxaloacetate-decarboxylating) (NADP) (EC 1.1.1.40) 2, cyt

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041M14+ AATATAGTA
                      ____________________________________________________________
consensus AATATAGTA
 
. : . : . : . : . : . :
JMSF041M14+ GTCATCCTTCAGTAACTTCTCATTGTTCGTCCCAACATCAATTGTTATAGGCAAACACGC
                      ____________________________________________________________
consensus GTCATCCTTCAGTAACTTCTCATTGTTCGTCCCAACATCAATTGTTATAGGCAAACACGC
 
. : . : . : . : . : . :
JMSF048I24+ CAGGAATTCCCA
JMSF041M14+ TGAGGGTCTGACACCACCAAGTGCTGTATAAAGAGCCAACTTCCCCACCAGGAATTCCCA
                      ____________________________________________________________
consensus TGAGGGTCTGACACCACCAAGTGCTGTATAAAGAGCCAACTTCCCCACCAGGAATTCCCA
 
. : . : . : . : . : . :
JMSF048I24+ TCCCCTGGCAGCCAAGGTCTCCAAGTCCCAAAATTCGCTCGCCATCTGTCACAACAATGA
JMFF047B02+ CAAAATTCGCTCGCCATCTGTCACAACAATGA
JMFS017C08+ CAAAATTCGCTCGCCATCTGTCACAACAATGA
JMFS074E02+ ATCTGTCACAACAATGA
JMFS065H04+ ATCTGTCACAACAATGA
JMSF041M14+ TCCCCTGGCAGCCAAGGTCTCCAAGTCCCAAAATTCGCTCGCCATCTGTCACAACAATGA
                      ____________________________________________________________
consensus TCCCCTGGCAGCCAAGGTCTCCAAGTCCCAAAATTCGCTCGCCATCTGTCACAACAATGA
 
. : . : . : . : . : . :
JMSF048I24+ CCTGGATTGACCTCTCA-GGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFF047B02+ CCTGGA-TGACCTCTCAGGGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFS017C08+ CCTGGATTGACCTCTCA-GGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFS074E02+ CCTGGATTGACCTCTCA-GGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFS065H04+ CCTGGATTGACCTCTCA-GGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMSF041M14+ CCTGGATTGACCTCTCA-GGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFF038P04+ CA-GGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFF013H10+ CTTCCCCTTTTCCTTC
JMFS116B09+ TTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFF008L21+ CAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
JMFF008D07+ TCCTTC
                      ____________________________________________________________
consensus CCTGGATTGACCTCTCA-GGCCAATTCTTCAATACCTCAAGAATCTTCCCCTTTTCCTTC
 
. : . : . : . : . : . :
JMSF048I24+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFF047B02+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFS017C08+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFS074E02+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFS065H04+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMSF041M14+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFF038P04+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFF013H10+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFS116B09+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFF008L21+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMSF015D08+ TCCATATTTTNGGCAAGCCTCA
JMFF008D07+ AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
JMFF041L15+ ACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
                      ____________________________________________________________
consensus AAACTGATGTATAGACCCTGAGGGCGCTTGAATATGCTTCCATATTTTTGGCAAGCCTCA
 
. : . : . : . : . : . :
JMSF048I24+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFF047B02+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFS017C08+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFS074E02+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFS065H04+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMSF041M14+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFF038P04+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFF013H10+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFS116B09+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFF008L21+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMSF015D08+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFF022A21+ GTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFF008D07+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
JMFF041L15+ CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
                      ____________________________________________________________
consensus CCAACAGTTGGAGTGTATACAATAGGTAGTAGTTCATCCACATTATCAATAAGAAGCTTG
 
. : . : . : . : . : . :
JMSF048I24+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFF047B02+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFS017C08+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFS074E02+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFS065H04+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMSF041M14+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFF038P04+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFF013H10+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFS116B09+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFF008L21+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMSF015D08+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFF022A21+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFF008D07+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
JMFF041L15+ TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
                      ____________________________________________________________
consensus TAGAACAGCCTTTCATTCCTCTCCTCAAGTTCCATCAGGGCCTGATACTTGTGTATTGGC
 
. : . : . : . : . : . :
JMSF048I24+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFF047B02+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFS017C08+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFS074E02+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFS065H04+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMSF041M14+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFF038P04+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFF013H10+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFS116B09+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFF008L21+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMSF015D08+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFF022A21+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFF008D07+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
JMFF041L15+ TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
                      ____________________________________________________________
consensus TGATCATATTGACGGATACTGTGCATTAGTTTCTTCTCCTGAAGCTCCTGGGAAACAATT
 
. : . : . : . : . : . :
JMSF048I24+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFF047B02+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFS017C08+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFS074E02+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFS065H04+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMSF041M14+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFF038P04+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFF013H10+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFS116B09+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFF008L21+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMSF015D08+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFF022A21+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFF008D07+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
JMFF041L15+ ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
                      ____________________________________________________________
consensus ACAGGAGGAAGAAGACCTCGGAGGTAATGAGCATCTCTTTCATTCTCCTTGAACGCAAGC
 
. : . : . : . : . : . :
JMSF048I24+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFF047B02+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTGGCCACGAGCAACAGAGGTAGTCCAG
JMFS017C08+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFS074E02+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFS065H04+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMSF041M14+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFF038P04+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFF013H10+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFS116B09+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFF008L21+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMSF015D08+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFF022A21+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFF008D07+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
JMFF041L15+ CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
                      ____________________________________________________________
consensus CCTTTGTTGTAACGAGGGTCTCTTAGCAAATTGTAGCCACTAGCAACAGAGGTAGTCCAG
 
. : . : . : . : . : . :
JMSF048I24+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFF047B02+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFS017C08+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFS074E02+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFS065H04+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMSF041M14+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFF038P04+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFF013H10+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFS116B09+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFF008L21+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMSF015D08+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFF022A21+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFF008D07+ GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
JMFF041L15+ GGGGTGACGAGATGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
                      ____________________________________________________________
consensus GGGGTGACGAGCTGATCTTCGGTGGCGCAATCCTCGCCGTACACGTCTTCTACACCGCCT
 
. : . : . : . : . : . :
JMSF048I24+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFF047B02+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFS017C08+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFS074E02+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFS065H04+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMSF041M14+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFF038P04+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFF013H10+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFS116B09+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFF008L21+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMSF015D08+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFF022A21+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFF008D07+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
JMFF041L15+ CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
                      ____________________________________________________________
consensus CCCGGCGTTGCTCGCGGCGACATTTGCAGCACCGTTTCTCCCCCTCTCTTCTCCTTCAGT
 
. : . : . : . : . : . :
JMSF048I24+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMFF047B02+ AAACTCTCC
JMFS017C08+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATC
JMFS074E02+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAG
JMFS065H04+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMSF041M14+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMFF038P04+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMFF013H10+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMFS116B09+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATC
JMFF008L21+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMSF015D08+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMFF022A21+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMFF008D07+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
JMFF041L15+ AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
                      ____________________________________________________________
consensus AAACTCTCCATTTCTCTCTCTCTATCTTTCTCTTTCTCTCTAGATAATCAGCGGTGACGG
 
. : . : . : . : . : . :
JMSF048I24+ TGCGATTGAC
JMFS065H04+ TGC
JMSF041M14+ TGCGATTGAC
JMFF038P04+ TGCGATTGACAC
JMFF013H10+ TGCGATTGAC
JMFF008L21+ TGCGATTGACAC
JMSF015D08+ TGCGATTGAC
JMFF022A21+ TGCGATTGACAC
JMFF008D07+ TGCGATTGACAC
JMFF041L15+ TGCGATTGACACTCTATTTCTGGCTTTCCGCCTGCCACCTTAAATACACGCATATTGAGC
                      ____________________________________________________________
consensus TGCGATTGACACTCTATTTCTGGCTTTCCGCCTGCCACCTTAAATACACGCATATTGAGC
 
. : . : . : . : . : . :
JMFF041L15+ ATATGCTTCTAGAGATGTAGAGAGAGATAACTACTGAAAGAGATGTAGAGAGAGATGGAC
                      ____________________________________________________________
consensus ATATGCTTCTAGAGATGTAGAGAGAGATAACTACTGAAAGAGATGTAGAGAGAGATGGAC