Previous Contig 001771:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006O22Sequence536001771 (13)gb:CAV295617_16456169e-65Corylus avellana mRNA for putative luminal binding protein.753003715 (12)pir|PQ0262|S218781e-70dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF011N22Sequence549001771 (13)sp|P24067|BIP2_MAIZE6e-55Luminal binding protein 2 precursor (BiP2) (Heat shock protein 70 homolog 2) (B7566003715 (12)pir|PQ0262|S218788e-52dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF014L10Sequence452001771 (13)gb:CAV295617_16456163e-47Corylus avellana mRNA for putative luminal binding protein.773003715 (12)pir|PQ0262|S218782e-78dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF024B19Sequence371001771 (13)gb:AF338252_17876563e-28Glycine max BiP-isoform D (BiPD) gene, partial cds.
JMFF027P09Sequence570001771 (13)gb:CAV295617_16456163e-68Corylus avellana mRNA for putative luminal binding protein.733003715 (12)pir|PQ0262|S218781e-75dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF033D24Sequence493001771 (13)gb:CAV295617_16456169e-57Corylus avellana mRNA for putative luminal binding protein.751003715 (12)pir|PQ0262|S218781e-74dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF038J07Sequence391001771 (13)gb:TOMBIPGRP_17256163e-36Tomato BiP (binding protein)/grp78 (glucose-regulated protein, 78 kD) (BiP/grp78733003715 (12)pir|PQ0262|S218781e-82dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFF041J04Sequence666001771 (13)gb:CAV295617_16456165e-68Corylus avellana mRNA for putative luminal binding protein.454003715 (12)sp|P49118|BIP_LYCES4e-26Luminal binding protein precursor (BiP) (78 kDa glucose-regulated protein homolo
JMFF042P07Sequence633001771 (13)gb:TOMBIPGRP_17256161e-74Tomato BiP (binding protein)/grp78 (glucose-regulated protein, 78 kD) (BiP/grp78
JMFF049K02Sequence629001771 (13)gb:TOMBIPGRP_17256168e-81Tomato BiP (binding protein)/grp78 (glucose-regulated protein, 78 kD) (BiP/grp78651003715 (12)pir|PQ0262|S218782e-57dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMFS044D07Sequence612001771 (13)gb:TOMBIPGRP_17256163e-75Tomato BiP (binding protein)/grp78 (glucose-regulated protein, 78 kD) (BiP/grp78
JMSF017D11Sequence476001771 (13)gb:CAV295617_16456169e-57Corylus avellana mRNA for putative luminal binding protein.768003715 (12)pir|PQ0262|S218787e-86dnaK-type molecular chaperone blp2 - common tobacco (fragment)
JMSF037E06Sequence595001771 (13)gb:TOMBIPGRP_17256161e-74Tomato BiP (binding protein)/grp78 (glucose-regulated protein, 78 kD) (BiP/grp78719003715 (12)pir|PQ0262|S218781e-76dnaK-type molecular chaperone blp2 - common tobacco (fragment)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049K02+ TCCCAAGGAATGCTTCAGCT
JMFS044D07+ TCCCAAGGAATGCTTCAGCT
JMFF042P07+ TCCCAAGGAATGCTTCAGCT
                      ____________________________________________________________
consensus TCCCAAGGAATGCTTCAGCT
 
. : . : . : . : . : . :
JMFF049K02+ GTCTCCTTCATCTTTGTTAGAATCATGGCACTGATTTCCTCAGGGCTGAAGACTTTAACT
JMFS044D07+ GTCTCCTTCATC-TTGTTAGAATCATGGCACTGATTTCCTCAGGGCTGAAGACTTTAACT
JMSF037E06+ GAATCATGGCACTGATTTCCTCAGGGCTGAAGACTTTAACT
JMFF042P07+ GTCTCCTTCATC-TTGTANGAATCATGGCACTGATTTCCTCAGGGCTGAAGACTTTAACT
JMFF027P09+ GAAGACTTTAACT
JMFF041J04+ CTTTAACT
                      ____________________________________________________________
consensus GTCTCCTTCATC-TTGTTAGAATCATGGCACTGATTTCCTCAGGGCTGAAGACTTTAACT
 
. : . : . : . : . : . :
JMFF049K02+ TCCCCATCTCTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
JMFS044D07+ TCCCCATCTCTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
JMSF037E06+ TCCCCATCTCTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
JMFF042P07+ TCCCCATCTCTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
JMFF027P09+ TCCCCATCTCTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
JMFF011N22+ CTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
JMFF006O22+ GATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
JMSF017D11+ GTAA
JMFF033D24+ GTAA
JMFF041J04+ TCCCCATCTCTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
                      ____________________________________________________________
consensus TCCCCATCTCTGATTTTGACTTGTATATAAGGCTTGCCATCCTTGTTAATAATCTTGTAA
 
. : . : . : . : . : . :
JMFF049K02+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMFS044D07+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMSF037E06+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMFF042P07+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMFF027P09+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMFF014L10+ AACTTTCTTCCAATAAGCCT
JMFF011N22+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTATCCCTCAAACTTTCTTCCAATAAGCCT
JMFF006O22+ GGAACAAGCTTCATATCCCTNTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMSF017D11+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMFF033D24+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
JMFF041J04+ GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
                      ____________________________________________________________
consensus GGAACAAGCTTCATATCCCTCTGGACTTCCTTAT-CCTCAAACTTTCTTCCAATAAGCCT
 
. : . : . : . : . : . :
JMFF049K02+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFS044D07+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMSF037E06+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFF042P07+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFF027P09+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFF014L10+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFF038J07+ GCAGCCTCACC
JMFF011N22+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFF024B19+ CC
JMFF006O22+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMSF017D11+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFF033D24+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
JMFF041J04+ CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
                      ____________________________________________________________
consensus CTTAACATCAAAGATAGTCCTTTCATGGTTGACAGCTGCCTGGTTCTTTGCAGCCTCACC
 
. : . : . : . : . : . :
JMFF049K02+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGGTC
JMFS044D07+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMSF037E06+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF042P07+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF027P09+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF014L10+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF038J07+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATNCGATTTCCTTGATC
JMFF011N22+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF024B19+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF006O22+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMSF017D11+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF033D24+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
JMFF041J04+ AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
                      ____________________________________________________________
consensus AATCAATCTTTCTGTGTCAGTGAATGCCACCCATGATGGTGTAATACGATTTCCTTGATC
 
. : . : . : . : . : . :
JMFF049K02+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFS044D07+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMSF037E06+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF042P07+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF027P09+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF014L10+ ATTTGCTATGATTTCAACATTACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF038J07+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF011N22+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF024B19+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF006O22+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMSF017D11+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF033D24+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
JMFF041J04+ ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
                      ____________________________________________________________
consensus ATTTGCTATGATTTCAACATGACCATTCTTGTAAACACCAACACAGGAGTAAGTTGTTCC
 
. : . : . : . : . : . :
JMFF049K02+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFS044D07+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMSF037E06+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF042P07+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF027P09+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTACTCCTTTGCGATAGAAATTGC
JMFF014L10+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF038J07+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF011N22+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF024B19+ AAGATCAATTCCAATAACAGTTCNTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF006O22+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMSF017D11+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF033D24+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
JMFF041J04+ AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
                      ____________________________________________________________
consensus AAGATCAATTCCAATAACAGTTCCTAATTTTGTTGCCTCCTCCTTTGCGATAGAAATTGC
 
. : . : . : . : . : . :
JMFF049K02+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFS044D07+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMSF037E06+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF042P07+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF027P09+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF014L10+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF038J07+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF011N22+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF024B19+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACCAGAACCACCTCGCCTCCAAT
JMFF006O22+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMSF017D11+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF033D24+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
JMFF041J04+ AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
                      ____________________________________________________________
consensus AGATAGACATCCAATGAAGACGATCGCTAGCACGACGACC-GAACCACCTCGCCTCCAAT
 
. : . : . : . : . : . :
JMFF049K02+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFS044D07+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMSF037E06+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF042P07+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF027P09+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATT
JMFF014L10+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF038J07+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF011N22+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF024B19+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF006O22+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMSF017D11+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF033D24+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
JMFF041J04+ AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
                      ____________________________________________________________
consensus AGCCTCCCACGGCCATGGTTTACCTGTCACTTCCTCTCTTCACCTACAAATCCTTTAATC
 
. : . : . : . : . : . :
JMFF049K02+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFS044D07+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGT
JMSF037E06+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF042P07+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF027P09+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF014L10+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF038J07+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF011N22+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF024B19+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF006O22+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMSF017D11+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACT
JMFF033D24+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
JMFF041J04+ GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
                      ____________________________________________________________
consensus GAAGACTGAGAGATAACTAGACGCTCCAAAAGCGAGCTCGAGAAGCGTCGACTGTGTTAT
 
. : . : . : . : . : . :
JMFF049K02+ AAGGGTGGCGA
JMSF037E06+ AAGGGTGGC
JMFF042P07+ AAGGGTGGCGACTGG
JMFF027P09+ AAGGGTGGCGACTGG
JMFF014L10+ AAGGGTGGCGACT
JMFF038J07+ AAGGGTGGCGACTGG
JMFF011N22+ AAGGGTGGCGACTGG
JMFF024B19+ AAGGGTGGC
JMFF006O22+ AAGGGTGGC
JMFF033D24+ AAGGGTGG
JMFF041J04+ AAGGGTGGCGACTGGCGACGTTAAGGGAGATCGGGTTTTGGGGAGGTTGAAGCGAGAGTG
                      ____________________________________________________________
consensus AAGGGTGGCGACTGGCGACGTTAAGGGAGATCGGGTTTTGGGGAGGTTGAAGCGAGAGTG
 
. : . : . : . : . : . :
JMFF041J04+ TAGACTGAGCAGTGATTCTCAGTTGGTACGTCCACCTGAAGATAATGGAGCCACACCGGT
                      ____________________________________________________________
consensus TAGACTGAGCAGTGATTCTCAGTTGGTACGTCCACCTGAAGATAATGGAGCCACACCGGT