Previous Contig 001759:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019E20Sequence570001759 (4)gb:AP000604_18204222e-44Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.668009218 (5)gb:AP000604_18204222e-26Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.
JMFF021H18Sequence581001759 (4)gb:AP000604_18204223e-45Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.727009218 (5)gb:AP000604_18204229e-37Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.
JMFF027H18Sequence512001759 (4)gb:AP000604_18204222e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.659009218 (5)gb:AP000604_18204224e-27Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.
JMFF041D06Sequence631001759 (4)gb:AP000604_18204222e-48Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.629009218 (5)gb:AP000604_18204229e-26Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSA6.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041D06+ TCTGTTGAAGGGTCATGTGTGTTATTNTCTC
                      ____________________________________________________________
consensus TCTGTTGAAGGGTCATGTGTGTTATTNTCTC
 
. : . : . : . : . : . :
JMFF019E20+ CCAAAGTGTTAAAGATTTATCTGCGGCAGATACAAGTATGCGGTG
JMFF021H18+ CCAAAGTGTTAAAGATTTATCTGCGGCAGATACAAGTATGCGGTG
JMFF041D06+ TCCATTGACAACATCCCAAAGTGTTAAAGATTTATCTGCGGCAGATACAAGTATGCGGTG
                      ____________________________________________________________
consensus TCCATTGACAACATCCCAAAGTGTTAAAGATTTATCTGCGGCAGATACAAGTATGCGGTG
 
. : . : . : . : . : . :
JMFF019E20+ ACCATACTTTGACCAACATACACTAGTGATGGCAGCAACACAGTCCTTATCTCTCAATTC
JMFF027H18+ CAACATACACTAGTGATGGCAGCAACACAGTCCTTATCTCTCAATTC
JMFF021H18+ ACCATACTTTGACCAACATACACTAGTGATGGCAGCAACACAGTCCTTATCTCTCAATTC
JMFF041D06+ ACCATACTTTGACCAACATACACTAGTGATGGCAGCAACACAGTCCTTATCTCTCAATTC
                      ____________________________________________________________
consensus ACCATACTTTGACCAACATACACTAGTGATGGCAGCAACACAGTCCTTATCTCTCAATTC
 
. : . : . : . : . : . :
JMFF019E20+ TTTAGAGATTCCTCTGGTCTCAAAATCCCAGATAATGCAGCTTCCATCAGAGCATCCAGC
JMFF027H18+ TTTAGAGATTCCTCTGGTCTCAAAATCCCAGATAATGCAGCTTCCATCAGAGCATCCAGC
JMFF021H18+ TTTAGAGATTCCTCTGGTCTCAAAATCCCAGATAATGCAGCTTCCATCAGAGCATCCAGC
JMFF041D06+ TTTAGAGATTCCTCTGGTCTCAAAATCCCAGATAATGCAGCTTCCATCAGAGCATCCAGC
                      ____________________________________________________________
consensus TTTAGAGATTCCTCTGGTCTCAAAATCCCAGATAATGCAGCTTCCATCAGAGCATCCAGC
 
. : . : . : . : . : . :
JMFF019E20+ AGCAAGAAGAGTTCCCCGACGATTAAAGGCAATGCATTTCATAACCCCATGCTCCAAATA
JMFF027H18+ AGCAAGAAGAGTTCCCCGACGATTAAAGGCAATGCATTTCATAACCCCATGCTCCAAATA
JMFF021H18+ AGCAAGAAGAGTTCCCCGACGATTAAAGGCAATGCATTTCATAACCCCATGCTCCAAATA
JMFF041D06+ AGCAAGAAGAGTTCCCCGACGATTAAAGGCAATGCATTTCATAACCCCATGCTCCAAATA
                      ____________________________________________________________
consensus AGCAAGAAGAGTTCCCCGACGATTAAAGGCAATGCATTTCATAACCCCATGCTCCAAATA
 
. : . : . : . : . : . :
JMFF019E20+ CTCTTCTATCACCTCCGGAAAATCCCCCTGCAATGGATCTATGATTGGGGCATTCATGGT
JMFF027H18+ CTCTTCTATCACCTCCGGAAAATCCCCCTGCAATGGATCTATGATTGGGGCATTCATGGT
JMFF021H18+ CTCTTCTATCACCTCCGGAAAATCCCCCTGCAATGGATCTATGATTGGGGCATTCATGGT
JMFF041D06+ CTCTTCTATCACCTCCGGAAAATCCCCCTGCAATGGATCTATGATTGGGGCATTCATGGT
                      ____________________________________________________________
consensus CTCTTCTATCACCTCCGGAAAATCCCCCTGCAATGGATCTATGATTGGGGCATTCATGGT
 
. : . : . : . : . : . :
JMFF019E20+ GCAACATTAAAGCTATGAAAAAACTTCACGAATCAAATGCTCCTTGCATCCGCATGGAGT
JMFF027H18+ GCAACATTAAAGCTATGAAAAAACTTCACGAATCAAATGCTCCTTGCATCCGCATGGAGT
JMFF021H18+ GCAACATTAAAGCTATGAAAAAACTTCACGAATCAAATGCTCCTTGCATCCGCATGGAGT
JMFF041D06+ GCAACATTAAAGCTATGAAAAAACTTCACGAATCAAATGCTCCTTGCATCCGCATGGAGT
                      ____________________________________________________________
consensus GCAACATTAAAGCTATGAAAAAACTTCACGAATCAAATGCTCCTTGCATCCGCATGGAGT
 
. : . : . : . : . : . :
JMFF019E20+ TCAAACTTGTAATTTAGGAGAAGCCAAATGTTCAACTGAATAATTGAAAATTTCTCGGTA
JMFF027H18+ TCAAACTTGTAATTTAGGAGAAGCCAAATGTTCAACTGAATAATTGAAAATTTCTCGGTA
JMFF021H18+ TCAAACTTGTAATTTAGGAGAAGCCAAATGTTCAACTGAATAATTGAAAATTTCTCGGTA
JMFF041D06+ TCAAACTTGTAATTTAGGAGAAGCCAAATGTTCAACTGAATAATTGAAAATTTCTCGGTA
                      ____________________________________________________________
consensus TCAAACTTGTAATTTAGGAGAAGCCAAATGTTCAACTGAATAATTGAAAATTTCTCGGTA
 
. : . : . : . : . : . :
JMFF019E20+ TATGCATATACACGAAGAAGACACAGAACTTATCAGAGGAAAGAAACCCCCCAAAAAATT
JMFF027H18+ TATGCATATACACGAAGAAGACACAGAACTTATCAGAGGAAAGAAACCCCCCAAAAAATT
JMFF021H18+ TATGCATATACACGAAGAAGACACAGAACTTATCAGAGGAAAGAAACCCCCCAAAAAATT
JMFF041D06+ TATGCATATACACGAAGAAGACACAGAACTTATCAGAGGAAAGAAACCCCCCAAAAAATT
                      ____________________________________________________________
consensus TATGCATATACACGAAGAAGACACAGAACTTATCAGAGGAAAGAAACCCCCCAAAAAATT
 
. : . : . : . : . : . :
JMFF019E20+ GAAATTTCTTTTCACCGGCGACCGTAGAATGAGAAGATTTCACCGGCGACGAGCTGTGGG
JMFF027H18+ GAAATTTCTTTTCACCGGCGACCGTAGAATGAGAAGATTTCACCGGCGACGAGCTGTGGG
JMFF021H18+ GAAATTTCTTTTCACCGGCGACCGTAGAATGAGAAGATTTCACCGGCGACGAGCTGTGGG
JMFF041D06+ GAAATTTCTTTTCACCGGCGACCGTAGAATGAGAAGATTTCACCGGCGACGAGCTGTGGG
                      ____________________________________________________________
consensus GAAATTTCTTTTCACCGGCGACCGTAGAATGAGAAGATTTCACCGGCGACGAGCTGTGGG
 
. : . : . : . : . : . :
JMFF019E20+ GTTTGAATGGGAAAAAAGTGCAAAAGATTCTCAGGGGATTTTGGG
JMFF027H18+ GTTTGAATGGGAAAAAAGTGCAAAAAATTCTCAGGGGATTTTGGG
JMFF021H18+ GTTTGAATGGGAAAAAAGTGCAAAAAATTCTCAGGGGATTTTGGGTCTACAAT
JMFF041D06+ GTTTGAATGGGAAAAAAGTGCAAAAAATTCTCAGGGGATTTTGGGTCTACAATCGGTTCT
                      ____________________________________________________________
consensus GTTTGAATGGGAAAAAAGTGCAAAAAATTCTCAGGGGATTTTGGGTCTACAATCGGTTCT