Previous Contig 001757:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005D08Sequence363001757 (8)731010820 (10)gb:FSY298992_16794262e-68Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.
JMFF026P24Sequence498001757 (8)735010820 (10)gb:FSY298992_16794262e-68Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.
JMFF029H22Sequence501001757 (8)730010820 (10)gb:FSY298992_16794262e-68Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.
JMFF041C22Sequence634001757 (8)gb:FSY298992_16794260.002Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.619010820 (10)pir|S29851|S298515e-16protein kinase 6 (EC 2.7.1.-) - soybean>gb:SOYPROKIN_1716079 Glycine max protein
JMFF042G06Sequence648001757 (8)gb:FSY298992_16794261e-05Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.597010820 (10)gb:FSPKF1PRO_16793138e-40F.sylvatica mRNA for PKF1 protein.
JMFF046O21Sequence644001757 (8)gb:FSY298992_16794261e-05Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.544010820 (10)gb:FSY298992_16794260.039Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.
JMFF048I01Sequence492001757 (8)574010820 (10)
JMSF016A21Sequence445001757 (8)753010820 (10)gb:FSY298992_16794264e-66Fagus sylvatica partial mRNA for protein kinase (pk1 gene), clone FsPK1.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046O21+ CTGGACAATGATAGGAAGGGAGGTCAACCTTGCTGCTTCTAACCTATGA
JMFF042G06+ GCTGGACAATGATAGGAAGGGAGGTCAACCTTGCTGCTTCTAACCTATGA
JMFF041C22+ AAGGGAGGTCAACCTNGCTGCTTCTAACCTATGA
                      ____________________________________________________________
consensus GCTGGACAATGATAGGAAGGGAGGTCAACCTTGCTGCTTCTAACCTATGA
 
. : . : . : . : . : . :
JMFF046O21+ TAAACAGTGTGAGAGAATTTTGTTCTCCTAATCCAAGATACCTCTTCATCCATCTTTCCA
JMFF042G06+ TAAACAGTGTGAGAGAATTTTGTTCTCCTAATCCAAGATACCTCTTCATCCATCTTTCCA
JMFF041C22+ TAAACAGTGTGAGAGAATTTTGTTCTCCTAATCCAAGATACCTCTTCATCCATCTTTCCA
                      ____________________________________________________________
consensus TAAACAGTGTGAGAGAATTTTGTTCTCCTAATCCAAGATACCTCTTCATCCATCTTTCCA
 
. : . : . : . : . : . :
JMFF046O21+ CCTACTAAAACACCAGGTAACTACCTCAATCTGTTTCAACTAAGAAGAAGGTTCAGATTC
JMFF042G06+ CCTACTAAAACACCAGGTAACTACCTCAATCTGTTTCAACTAAGAAGAAGGTTCAGATTC
JMFF048I01+ GAAGAAGGTTCAGATTC
JMFF026P24+ TAAGAAGAAGGTTCAGATTC
JMFF029H22+ TAAGAAGAAGGTTCAGATTC
JMFF041C22+ CCTACTAAAACACCAGGTAACTACCTCAATCTGTTTCAACTAAGAAGAAGGTTCAGATTC
                      ____________________________________________________________
consensus CCTACTAAAACACCAGGTAACTACCTCAATCTGTTTCAACTAAGAAGAAGGTTCAGATTC
 
. : . : . : . : . : . :
JMFF046O21+ AACAATTCCCTTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
JMFF042G06+ AACAATTCCCTTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
JMFF048I01+ AACAATCCCCTTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
JMFF005D08+ TTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
JMFF026P24+ AACAATTCCCTTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
JMFF029H22+ AACAATTCCCTTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
JMSF016A21+ GTCTGTACTCCCATACACAAACATT
JMFF041C22+ AACAATTCCCTTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
                      ____________________________________________________________
consensus AACAATTCCCTTCAGAAGCCCAAGAAGGAAAAGATGTCTGTACTCCCATACACAAACATT
 
. : . : . : . : . : . :
JMFF046O21+ CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
JMFF042G06+ CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
JMFF048I01+ CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
JMFF005D08+ CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
JMFF026P24+ CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
JMFF029H22+ CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCNTGCAAGAATC
JMSF016A21+ NTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
JMFF041C22+ CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
                      ____________________________________________________________
consensus CTCCAGACCCATCAAAGTTTAAGGATGAAGAAACATTCAACCTTTTGGCCTGCAAGAATC
 
. : . : . : . : . : . :
JMFF046O21+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
JMFF042G06+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
JMFF048I01+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
JMFF005D08+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
JMFF026P24+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
JMFF029H22+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
JMSF016A21+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
JMFF041C22+ CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
                      ____________________________________________________________
consensus CTTCAAACTACACACTAAACCACCATAGACTTATTCTTGAATCACCAACTAAAGCAGAGA
 
. : . : . : . : . : . :
JMFF046O21+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
JMFF042G06+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
JMFF048I01+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
JMFF005D08+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
JMFF026P24+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
JMFF029H22+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
JMSF016A21+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
JMFF041C22+ GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
                      ____________________________________________________________
consensus GCTCCTAAATCTATCCCTACTTGCCAAAAGATCAAAACTTTACTCTCAAACCAATCCATA
 
. : . : . : . : . : . :
JMFF046O21+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
JMFF042G06+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
JMFF048I01+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
JMFF005D08+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
JMFF026P24+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
JMFF029H22+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
JMSF016A21+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
JMFF041C22+ CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
                      ____________________________________________________________
consensus CCTACCAAGAACAACCTCCATGACCATAAAAGTGGGAGCTATAACTAACAATATGACCTC
 
. : . : . : . : . : . :
JMFF046O21+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
JMFF042G06+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
JMFF048I01+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
JMFF005D08+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
JMFF026P24+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
JMFF029H22+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
JMSF016A21+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
JMFF041C22+ AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
                      ____________________________________________________________
consensus AAACAGCAGAAGCAAGAAGGCTCTCTTTCAGCTTCAAAGTCAAACACCACCACCACCTTC
 
. : . : . : . : . : . :
JMFF046O21+ CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
JMFF042G06+ CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
JMFF048I01+ CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
JMFF005D08+ CTTTGAAGCCGTA
JMFF026P24+ CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
JMFF029H22+ CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
JMSF016A21+ CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
JMFF041C22+ CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
                      ____________________________________________________________
consensus CTTTGAAGCCGTAAGCATACATTTCCCCCTAATACTAAACTCCCTCGTTCTTCAAAAGAT
 
. : . : . : . : . : . :
JMFF046O21+ TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTC
JMFF042G06+ TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTCTC
JMFF048I01+ TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTC
JMFF026P24+ TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTCTC
JMFF029H22+ TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTCTC
JMSF016A21+ TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTCTC
JMFF041C22+ TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTCTCTCT
                      ____________________________________________________________
consensus TCTCCGGGAAAACCCCCATCTTTGACGCGAATGCTCCCTTTCTTTTCTCTCTCTCTCTCT