Previous Contig 001753:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021P14Sequence561001753 (5)pir|T04648|T046484e-33cytochrome P450 F10N7.220 - Arabidopsis thaliana>gb:ATCHRIV76_1547118 Arabidopsi737001753 (5)gb:AB015762_15127291e-62Nicotiana tabacum CYP82E1 mRNA for cytochrome P450, complete cds.>gb:AF368381_17
JMFF041C07Sequence657001753 (5)pir|T05942|T059422e-39cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m541001753 (5)gb:AB015762_15127297e-46Nicotiana tabacum CYP82E1 mRNA for cytochrome P450, complete cds.>gb:AF368381_17
JMFS119H03Sequence622001753 (5)pir|T04651|T046514e-41cytochrome P450 F10N7.250 - Arabidopsis thaliana>gb:ATCHRIV76_1547115 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF021P14- TATA
                      ____________________________________________________________
consensus TATA
 
. : . : . : . : . : . :
rJMFF041C07- ATTAAAGACTTTTATTTGACCACATAGAAAATTAAAAA
rJMFF021P14- TGCATGTATACACCATGCATATATTAAAGACTTTTATTTGACCACATAGAAAATTAAAAA
                      ____________________________________________________________
consensus TGCATGTATACACCATGCATATATTAAAGACTTTTATTTGACCACATAGAAAATTAAAAA
 
. : . : . : . : . : . :
rJMFF041C07- ACATACATCCGCATTAAGCATATATATGCTTATAATCTAAATAGAGTAGGAGATAAACGC
rJMFF021P14- ACATACATCCGCATTAAGCATATATATGCTTATAATCTAAATAGAGTAGGAGATAAACGC
                      ____________________________________________________________
consensus ACATACATCCGCATTAAGCATATATATGCTTATAATCTAAATAGAGTAGGAGATAAACGC
 
. : . : . : . : . : . :
rJMFF041C07- GGTGTAACAAGTACTTCTAAAGGAGTTAACTTAGGCAAGATAATGCCTACGTCTTCCATC
rJMFF021P14- GGTGTAACAAGTACTTCTAAAGGAGTTAACTTAGGCAAGATAATGCCTACGTCTTCCATC
                      ____________________________________________________________
consensus GGTGTAACAAGTACTTCTAAAGGAGTTAACTTAGGCAAGATAATGCCTACGTCTTCCATC
 
. : . : . : . : . : . :
rJMFF041C07- ATGTCCAATGGCTCATTTGGAACTGTGCTGAAATTAAAGCCTTGAAATAGTCGAGCAACT
rJMFF021P14- ATGTCCAATGGCTCATTTGGAACTGTGCTGAAATTAAAGCCTTGAAATAGTCGAGCAACT
                      ____________________________________________________________
consensus ATGTCCAATGGCTCATTTGGAACTGTGCTGAAATTAAAGCCTTGAAATAGTCGAGCAACT
 
. : . : . : . : . : . :
rJMFF041C07- GCAACTTGTGTAATTTGTGTTGCATATAAATTTCCAGGACATGATCGTCGTCCAAGACCA
rJMFF021P14- GCAACTTGTGTAATTTGTGTTGCATATAAATTTCCAGGACATGATCGTCGTCCAAGACCA
                      ____________________________________________________________
consensus GCAACTTGTGTAATTTGTGTTGCATATAAATTTCCAGGACATGATCGTCGTCCAAGACCA
 
. : . : . : . : . : . :
rJMFF041C07- AATGGGACAAACTGATACTGTCTATTTTGGGCAGCTTCCCCTTCTAAATTTGTCATGAAC
rJMFF021P14- AATGGGACAAACTGATACTGTCTATTTTGGGCAGCTTCCCCTTCTAAATTTGTCATGAAC
                      ____________________________________________________________
consensus AATGGGACAAACTGATACTGTCTATTTTGGGCAGCTTCCCCTTCTAAATTTGTCATGAAC
 
. : . : . : . : . : . :
rJMFF041C07- CTTTCTGGTAAAAACTTTTCTGGGTCAGGCCAGATTTTAGGATCGCGATGCAATCTCCAC
rJMFF021P14- CTTTCTGGTAAAAACTTTTCTGGGTCAGGCCAGATTTTAGGATCGCGATGCAATCTCCAC
                      ____________________________________________________________
consensus CTTTCTGGTAAAAACTTTTCTGGGTCAGGCCAGATTTTAGGATCGCGATGCAATCTCCAC
 
. : . : . : . : . : . :
rJMFF041C07- ACATTGACGTATAGTTGTGTGCCCTTTGGGATGTGATAGCCATCTACTATACAATCTTCC
rJMFF021P14- ACATTGACGTATAGTTGTGTGCCCTTTGGGATGTGATAGCCATCTACTATACAATCTTCC
JMFS119H03+ TACTATACAATCTTCC
                      ____________________________________________________________
consensus ACATTGACGTATAGTTGTGTGCCCTTTGGGATGTGATAGCCATCTACTATACAATCTTCC
 
. : . : . : . : . : . :
rJMFF041C07- ACCGTTTCGTGTGGAGCTAGGTATGGTCCTTGTGGGTACATTCGCAGTGTTTCTTTAACT
rJMFF021P14- ACCGCTTCGTGTGGAGCTAGGTATGGTCCTTGTGGGTACATTCGCAGTGTTTCTTTAACT
JMFS119H03+ ACCGCTTCGTGTGGAGCTAGGTATGGTCCTTGTGGGTACATTCGCAGTGTTTCTTTAACT
                      ____________________________________________________________
consensus ACCGCTTCGTGTGGAGCTAGGTATGGTCCTTGTGGGTACATTCGCAGTGTTTCTTTAACT
 
. : . : . : . : . : . :
rJMFF041C07- ACACCTTGAAGGTATGGTAAATT
rJMFF021P14- ACACCTTGAAGGTATGGTAAATTCTTAACATCAGAATCTTCTGCCCACCTTTCTTTGCCA
JMFS119H03+ ACACCTTGAAGGTATGGTAAATTCTTAACATCAGAATCTTCTGCCCACCTTTCTTTGCCA
                      ____________________________________________________________
consensus ACACCTTGAAGGTATGGTAAATTCTTAACATCAGAATCTTCTGCCCACCTTTCTTTGCCA
 
. : . : . : . : . : . :
rJMFF021P14- ATGTTGGTGTCTATCTCATCCTGAACACGCTTCAACGATTCTGGGTGTTTTAGCAATACA
JMFS119H03+ ATGTTGGTGTCTATCTCATCCTGAACACGCTTCAACGATTCTGGGTGTTTTAGCAATACA
                      ____________________________________________________________
consensus ATGTTGGTGTCTATCTCATCCTGAACACGCTTCAACGATTCTGGGTGTTTTAGCAATACA
 
. : . : . : . : . : . :
rJMFF021P14- GCCAATATCCATGTCAAGTGAGTCGCAAACGTTTCACTAGCATCTTGTAACATACTCAAT
JMFS119H03+ GCCAATATCCATGTCAAGTGAGTCGCAAACGTTTCACTAGCATCTTGTAACATACTCAAT
                      ____________________________________________________________
consensus GCCAATATCCATGTCAAGTGAGTCGCAAACGTTTCACTAGCATCTTGTAACATACTCAAT
 
. : . : . : . : . : . :
rJMFF021P14- ACAATTGCTTTGA
JMFS119H03+ ACAATTGCTTTGATTACTGTGTCCCGGGAGTAACTGTAACCTTGGGTAAATTGATCATCA
                      ____________________________________________________________
consensus ACAATTGCTTTGATTACTGTGTCCCGGGAGTAACTGTAACCTTGGGTAAATTGATCATCA
 
. : . : . : . : . : . :
JMFS119H03+ ATCATAGAAAGCATAACATCAATAAACTTTTGATCTTCATTACTTCTCCTCTCCTTCCTC
                      ____________________________________________________________
consensus ATCATAGAAAGCATAACATCAATAAACTTTTGATCTTCATTACTTCTCCTCTCCTTCCTC
 
. : . : . : . : . : . :
JMFS119H03+ CTAGCATCCACCCAATCTTGCAAGATGGCATCCACATCCTTTGCAGCTCTTTTCATGGTC
                      ____________________________________________________________
consensus CTAGCATCCACCCAATCTTGCAAGATGGCATCCACATCCTTTGCAGCTCTTTTCATGGTC
 
. : . : . : . : . : . :
JMFS119H03+ TTGACATGGCCTTCATAGTCCAACCACCTGAAAAACCAGAGTGGAAATATGGCATCCCCG
                      ____________________________________________________________
consensus TTGACATGGCCTTCATAGTCCAACCACCTGAAAAACCAGAGTGGAAATATGGCATCCCCG
 
. : . : . : . : . : . :
JMFS119H03+ GAGACAAACTCACCCCACAGATACATAACTTGGCTAAACACCTTCTTGAGACGCTGTGCC
                      ____________________________________________________________
consensus GAGACAAACTCACCCCACAGATACATAACTTGGCTAAACACCTTCTTGAGACGCTGTGCC
 
. : . : . : . : . : . :
JMFS119H03+ TCCTCGTTGATCGTCCCGTCACTCCGGTACTCGTACCTCCTGCCGGCGACTATCTGCATT
JMFF041C07+ TCGTTGATCGTCCCGTCACTCCGGTACTCGTACCTCCTGCCGGCGACTATCTGCATT
                      ____________________________________________________________
consensus TCCTCGTTGATCGTCCCGTCACTCCGGTACTCGTACCTCCTGCCGGCGACTATCTGCATT
 
. : . : . : . : . : . :
JMFS119H03+ ATCAAA
JMFF021P14+ CTCATGTTCACTTTGGGAGCGGAGGGG
JMFF041C07+ ATCAAATTCAACGTTAAATGTCCGAACCATCTGCTCATGTTCACTTTGGGAGCGGAGGGG
                      ____________________________________________________________
consensus ATCAAATTCAACGTTAAATGTCCGAACCATCTGCTCATGTTCACTTTGGGAGCGGAGGGG
 
. : . : . : . : . : . :
JMFF021P14+ TTGTTGTTATCCATGGAAATAAAAGTGTAGAGTTCTTTGATGTTGGTTTGCAGCTCCGAC
JMFF041C07+ TTGTTGTTATCCATGGAAATAAAAGTGTAGAGTTCTTTGATGTTGGTTTGCAGCTCCGAC
                      ____________________________________________________________
consensus TTGTTGTTATCCATGGAAATAAAAGTGTAGAGTTCTTTGATGTTGGTTTGCAGCTCCGAC
 
. : . : . : . : . : . :
JMFF021P14+ ACCCAAACATGTTTCAGTTTCTCAAGTCTTCTGCTGGAGAGTATCTCCTCCACCACCAAT
JMFF041C07+ ACCCAAACATGTTTCAGTTTCTCAAGTCTTCTGCTGGAGAGTATCTCCTCCACCACCAAT
                      ____________________________________________________________
consensus ACCCAAACATGTTTCAGTTTCTCAAGTCTTCTGCTGGAGAGTATCTCCTCCACCACCAAT
 
. : . : . : . : . : . :
JMFF021P14+ TTTCGTACTCTTCGCCAATATGAATTATTTGTTGAGAAAGTAAAGACCGCATAATCGTAG
JMFF041C07+ TTTCGTACTCTTCGCCAATATGAATTATTTGTTGAGAAAGTAAAGACCGCATAATCGTAG
                      ____________________________________________________________
consensus TTTCGTACTCTTCGCCAATATGAATTATTTGTTGAGAAAGTAAAGACCGCATAATCGTAG
 
. : . : . : . : . : . :
JMFF021P14+ CCAAGGTATTTACCTGCACATGTAGTTGGACGTGCAGCCAAGAGCTTATCGTTAGTAGCG
JMFF041C07+ CCAAGGTATTTACCTGCACATGTAGTTGGACGTGCAGCCAAGAGCTTATCGTTAGTAGCG
                      ____________________________________________________________
consensus CCAAGGTATTTACCTGCACATGTAGTTGGACGTGCAGCCAAGAGCTTATCGTTAGTAGCG
 
. : . : . : . : . : . :
JMFF021P14+ AAGCAATCCCTGACGGCTTCCCAGCTACTAACCACCAGGATCCGGGATATGCCGAGGCGG
JMFF041C07+ AAGCAATCCCTGACGGCTTCCCAGCTACTAACCACCAGGATCCGGGATATGCCGAGGCGG
                      ____________________________________________________________
consensus AAGCAATCCCTGACGGCTTCCCAGCTACTAACCACCAGGATCCGGGATATGCCGAGGCGG
 
. : . : . : . : . : . :
JMFF021P14+ ATGGTGAACACCGGACCATATTTATCCGCCCACTCGCTCAAAGTCTTAACCAAAGGAACC
JMFF041C07+ ATGGTGAACACCGGACCATATTTATCCGCCCACTCGCTCAAAGTCTTAACCAAAGGAACC
                      ____________________________________________________________
consensus ATGGTGAACACCGGACCATATTTATCCGCCCACTCGCTCAAAGTCTTAACCAAAGGAACC
 
. : . : . : . : . : . :
JMFF021P14+ GAGGTTCGGAAGTGGTGGAGGTGGCCAATAATAGGCCACGCGCCACCTGCCTCCGGTGGC
JMFF041C07+ GAGGTTCGGAAGTGGTGGAGGTGGCCAATAATAGGCCACGCGCCACCTGCCTCCGGTGGC
                      ____________________________________________________________
consensus GAGGTTCGGAAGTGGTGGAGGTGGCCAATAATAGGCCACGCGCCACCTGCCTCCGGTGGC
 
. : . : . : . : . : . :
JMFF021P14+ AATCTCTTGCTCTGTTTTCGCCATGAAAACCAAAGCAGCACCAAAGCTGCAATGCCAAGA
JMFF041C07+ AATCTCTTGCTCTGTTTTCGCCATGAAAACCAAAGCAGCACCAAAGCTGCAATGCCAAGA
                      ____________________________________________________________
consensus AATCTCTTGCTCTGTTTTCGCCATGAAAACCAAAGCAGCACCAAAGCTGCAATGCCAAGA
 
. : . : . : . : . : . :
JMFF021P14+ ATGGATGATAAACAACACGGAACCGCATCCATGACACACTTAATTCTCTCACTC
JMFF041C07+ ATGGATGATAAACAACACGGAACCGCATCCATGACACACTTAATTCTCTCACTCGAGTAT
                      ____________________________________________________________
consensus ATGGATGATAAACAACACGGAACCGCATCCATGACACACTTAATTCTCTCACTCGAGTAT