Previous Contig 001749:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040O22Sequence567001749 (3)gb:AF068724_17656521e-59Nicotiana tabacum MADS-box protein MADS5 (NtMADS5) mRNA, complete cds.774001749 (3)gb:AY306146_15975995e-42Corylopsis sinensis euAP1 APETALA1-like MADS-box (CsAP1) mRNA, partial cds.
JMFN031C19Sequence626001749 (3)gb:AY306146_15975992e-38Corylopsis sinensis euAP1 APETALA1-like MADS-box (CsAP1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040O22- CAATTAAGAAGGCAAAACTAATAATATACACCATAAGGTTCAAATGTCACAAACATC
                      ____________________________________________________________
consensus CAATTAAGAAGGCAAAACTAATAATATACACCATAAGGTTCAAATGTCACAAACATC
 
. : . : . : . : . : . :
JMFN031C19+ CGAAGAGTTGTTGTGTCTTAATTATNTAGTTTCACTTACAGCACAGTAC
rJMFF040O22- ATCAGGAACTCCGAAGAGTTGTTGTGTCTTAATTATTTAGTTTCACTTACAGCACAGTAC
                      ____________________________________________________________
consensus ATCAGGAACTCCGAAGAGTTGTTGTGTCTTAATTATTTAGTTTCACTTACAGCACAGTAC
 
. : . : . : . : . : . :
JMFN031C19+ TTGAATATATAGGGTAGTTACCCAGAACACGGAGGGCAGATGAAATCATTAATAATAACA
rJMFF040O22- TTGAATATATAGGGTAGTTACCCAGAACACGGAGGGCAGATGAAATCATTAATAATAACA
                      ____________________________________________________________
consensus TTGAATATATAGGGTAGTTACCCAGAACACGGAGGGCAGATGAAATCATTAATAATAACA
 
. : . : . : . : . : . :
JMFN031C19+ TACTTAATTAGTACTATATATAATATATTTTATATATAGATTCATTGGTTCATGAAGCAA
rJMFF040O22- TACTTAATTAGTACTATATATAATATATTTTATATATAGATTCATTGGTTCATGAAGCAA
                      ____________________________________________________________
consensus TACTTAATTAGTACTATATATAATATATTTTATATATAGATTCATTGGTTCATGAAGCAA
 
. : . : . : . : . : . :
JMFN031C19+ AGCATCCAAGATGGCATGGAGGATAGAGTGAATCAAGATTAAGGTCTAGGTCATTGTTGT
rJMFF040O22- AGCATCCAAGATGGCATGGAGGATAGAGTGAATCAAGATTAAGGTCTAGGTCATTGTTGT
                      ____________________________________________________________
consensus AGCATCCAAGATGGCATGGAGGATAGAGTGAATCAAGATTAAGGTCTAGGTCATTGTTGT
 
. : . : . : . : . : . :
JMFN031C19+ TCCTCCTTGCTTCATCTGCTGCTTCTCCTCCTTGGTAGCTCCCCCCAATGTTTAAGCCTG
rJMFF040O22- TCCTCCTTGCTTCATCTGCTGCTTCTCCTCCTTGGTAGCTCCCCCCAATGTTTAAGCCTG
JMFF040O22+ GGTAGCTCCCCCCAATGTTTAAGCCTG
                      ____________________________________________________________
consensus TCCTCCTTGCTTCATCTGCTGCTTCTCCTCCTTGGTAGCTCCCCCCAATGTTTAAGCCTG
 
. : . : . : . : . : . :
JMFN031C19+ GAAGAGATGGCTGTTGAAAGAGGAAGGATGATGAGCCAGGAGGGACTTGATGATTTTGCT
rJMFF040O22- GAAGAGATGGCTGTTGAAAGAGGAAGGATGATGAGCCAGGAGGGACTTGATGATTTTGCT
JMFF040O22+ GAAGAGATGGCTGTTGAAAGAGGAAGGATGATGAGCCAGGAGGGACTTGATGATTTTGCT
                      ____________________________________________________________
consensus GAAGAGATGGCTGTTGAAAGAGGAAGGATGATGAGCCAGGAGGGACTTGATGATTTTGCT
 
. : . : . : . : . : . :
JMFN031C19+ GCTCCCATGGTGCCTGTGGTTGTGCTGCCGCTGCTGCTGCAGCACTCTTCTCCTTCTCCT
rJMFF040O22- GCTCCCATGGTGCCTGTGGTTGTGCTGCCGCTGCTGCTGCAGCACTCTTCTCCTTCTCCT
JMFF040O22+ GCTCCCATGGTGCCTGTGGTTGTGCTGCCGCTGCTGCTGCAGCACTCTTCTCCTTCTCCT
                      ____________________________________________________________
consensus GCTCCCATGGTGCCTGTGGTTGTGCTGCCGCTGCTGCTGCAGCACTCTTCTCCTTCTCCT
 
. : . : . : . : . : . :
JMFN031C19+ TGATCTTCTTTGCTAGCATGTTATTTTCCTCGCGAATCGCCCTTTCCTTTTTTTGAAGCT
rJMFF040O22- TGATCTTCTTTGCTAGCATGTTATTTTCCTCGCGAATCGCCCTTTCCTTTTTTTGAAGCT
JMFF040O22+ TGATCTTCTTTGCTAGCATGTTATTTTCCTCGCGAATCGCCCTTTCCTTTTTTTGAAGCT
                      ____________________________________________________________
consensus TGATCTTCTTTGCTAGCATGTTATTTTCCTCGCGAATCGCCCTTTCCTTTTTTTGAAGCT
 
. : . : . : . : . : . :
JMFN031C19+ CAGAAAGCGATTCGTACAGCAATTGGTTTCTTCTGGATCGAATTAGTTTAAGAGAAGAAT
rJMFF040O22- CAGAAAGCGATTCGTACAGCAATTGGTTTCTTCTGGATCGAATTAGTTTAAGAGAAGAAT
JMFF040O22+ CAGAAAGCGATTCGTACAGCAATTGGTTTCTTCTGGATCGAATTAGTTTAAGAGAAGAAT
                      ____________________________________________________________
consensus CAGAAAGCGATTCGTACAGCAATTGGTTTCTTCTGGATCGAATTAGTTTAAGAGAAGAAT
 
. : . : . : . : . : . :
JMFN031C19+ CAAGTTGCTGCTCCAAATTCTGCAGATCTTTCAAGCTCAATGTGTCAAGATCTTCTCCCA
rJMFF040O22- CAAGTTGCTGCTCCAAATTCTGCAGATCTTTCAAGCTCAATGTGTCAAGATCTTCTCCCA
JMFF040O22+ CAAGTTGCTGCTCCAAATTCTGCAGATCTTTCAAGCTCAATGTGTCAAGATCTTCTCCCA
                      ____________________________________________________________
consensus CAAGTTGCTGCTCCAAATTCTGCAGATCTTTCAAGCTCAATGTGTCAAGATCTTCTCCCA
 
. : . : . : . : . : . :
JMFN031C19+ TGTAGTGCTTGTGATTCCTTTTCAGAAGCTCAACCTT
rJMFF040O22- TGTAGTGCTTGTGATTCCTTTTCAGAAGCTCAACCTTGGCCTTCAGCTTAGCGTATTCCA
JMFF040O22+ TGTAGTGCTTGTGATTCCTTTTCAGAAGCTCAACCTTGGCCTTCAGCTTAGCGTATTCCA
                      ____________________________________________________________
consensus TGTAGTGCTTGTGATTCCTTTTCAGAAGCTCAACCTTGGCCTTCAGCTTAGCGTATTCCA
 
. : . : . : . : . : . :
rJMFF040O22- ACGTCCNATTTTCCGATGATTCAGAGTTATTAGCAAGCAAGCGTCTCTCTGCGTATG
JMFF040O22+ ACGTCCAATTTTCCGATGATTCAGAGTTATTAGCAAGCAAGCGTCTCTCTGCGTATGAAT
                      ____________________________________________________________
consensus ACGTCCAATTTTCCGATGATTCAGAGTTATTAGCAAGCAAGCGTCTCTCTGCGTATGAAT
 
. : . : . : . : . : . :
JMFF040O22+ ATCGTTCATATCGCTCCAGAATCTTCTCCATGCAGGAATCAGTTGAGTATTCAAAAAGCT
                      ____________________________________________________________
consensus ATCGTTCATATCGCTCCAGAATCTTCTCCATGCAGGAATCAGTTGAGTATTCAAAAAGCT
 
. : . : . : . : . : . :
JMFF040O22+ TTCCCTTATGGGAGAAGACAATCAAGCCCACTTCTGCATCACAGAGCACAGAGATTTCAT
                      ____________________________________________________________
consensus TTCCCTTATGGGAGAAGACAATCAAGCCCACTTCTGCATCACAGAGCACAGAGATTTCAT