Previous Contig 001748:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027A08Sequence578001748 (6)pir|C96814|C968146e-76hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895753010261 (4)pir|C96814|C968145e-81hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF040O12Sequence584001748 (6)pir|C96814|C968146e-77hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895759010261 (4)pir|C96814|C968142e-81hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMFF041A16Sequence597001748 (6)pir|C96814|C968142e-79hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895240010261 (4)gb:AF051236_17642250.031Picea mariana hypothetical protein (Sb50) mRNA, partial cds.
JMFF042A20Sequence636001748 (6)pir|C96814|C96814e-113hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895562021630gb:AF051236_17642256e-42Picea mariana hypothetical protein (Sb50) mRNA, partial cds.
JMFF042O07Sequence653001748 (6)pir|C96814|C968143e-91hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895621010261 (4)gb:AF051236_17642254e-54Picea mariana hypothetical protein (Sb50) mRNA, partial cds.
JMFS070C09Sequence631001748 (6)pir|C96814|C968142e-85hypothetical protein T30F21.10 [imported] - Arabidopsis thaliana>gb:AE005173_895

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042A20+ CATATATCTCTAGCAACATCGGTCACTCTCCTCTC
                      ____________________________________________________________
consensus CATATATCTCTAGCAACATCGGTCACTCTCCTCTC
 
. : . : . : . : . : . :
JMFF042A20+ CTTCTTTGTCCCGATGTTGTATACATGACCAAGCTCTCCCCTGTGAAGAACCACCTCGAA
                      ____________________________________________________________
consensus CTTCTTTGTCCCGATGTTGTATACATGACCAAGCTCTCCCCTGTGAAGAACCACCTCGAA
 
. : . : . : . : . : . :
JMFF042A20+ AGCCTCTGCAACATCCTCACAGTAAAGATAGCTCCTGACGTTAGAACCATCTCCATGAAT
                      ____________________________________________________________
consensus AGCCTCTGCAACATCCTCACAGTAAAGATAGCTCCTGACGTTAGAACCATCTCCATGAAT
 
. : . : . : . : . : . :
JMFF042A20+ AGGGAGAGTCTTCCCCTGCATGGCTAAAAGAATGAACTTAGGGATTAGCTTCTCAGGGAA
JMFF042O07+ TCAGGGAA
                      ____________________________________________________________
consensus AGGGAGAGTCTTCCCCTGCATGGCTAAAAGAATGAACTTAGGGATTAGCTTCTCAGGGAA
 
. : . : . : . : . : . :
JMFF042A20+ CTGGTTGGGGCCGTACACATTATTCCCTCGGGTGGTTATTACAGGCAAGCCGTATGACCT
JMFS070C09+ GGGCCGTACACATTATTCCCTCGGGTGGTTA-TACAGGCAAGCCGTATGACCT
JMFF042O07+ CTGG-TGGGGCCGTACACATTATTCCCTCGGGTGGTTATTACAGGCAAGCCGTATGACCT
JMFF041A16+ CT
                      ____________________________________________________________
consensus CTGGTTGGGGCCGTACACATTATTCCCTCGGGTGGTTATTACAGGCAAGCCGTATGACCT
 
. : . : . : . : . : . :
JMFF042A20+ TCCATAAGCCATAACCAGCATTTCTGCCCCGGCTTTTGTAGCAGAATATGGGTTCGTGGG
JMFS070C09+ TCCATAAGCCATAACCAGCATTTCTGCCCCGGCTTTTGTAGCAGAATATGGGTTCGTGGG
JMFF042O07+ TCCATAAGCCATAACCAGCATTTCTGCCCCGGCTTTTGTAGCAGAATATGGGTTCGTGGG
JMFF041A16+ TCCATAAGCCATAACCAGCATTTCTGCCCCGGCTTTTGTAGCAGAATATGGGTTCGTGGG
JMFF027A08+ TTCTGCCCCGGCTTTTGTAGCAGAATATGGGTTCGTGGG
JMFF040O12+ ACCAGCATTTCTGCCCCGGCTTTTGTAGCAGAATATGGGTTCGTGGG
                      ____________________________________________________________
consensus TCCATAAGCCATAACCAGCATTTCTGCCCCGGCTTTTGTAGCAGAATATGGGTTCGTGGG
 
. : . : . : . : . : . :
JMFF042A20+ AAGAAGCTGCGAGGCTTCATGGTTTCCCACGATGGCGTCCTCCTCAGTCTCCCCATAGAC
JMFS070C09+ AAGAAGCTGCGAGGCTTCATGGTTTCCCACGATGGCGTCCTCCTCAGTCTCCCCATAGAC
JMFF042O07+ AAGAAGCTGCGAGGCTTCATGGTTTCCCACGATGGCGTCCTCCTCAGTCTCCCCATAGAC
JMFF041A16+ AAAAAGCTGCGAGGCTTCATGGTTTCCCACGATGGCATCCTCCTCAGTCTCCCCATAGAC
JMFF027A08+ AAGAAGCTGCGAGGCTTCATGGTTTCCCACGATGGCGTCCTCCTCAGTCTCCCCATAGAC
JMFF040O12+ AAGAAGCTGCGAGGCTTCATGGTTTCCCACGATGGCGTCCTCCTCAGTCTCCCCATAGAC
                      ____________________________________________________________
consensus AAGAAGCTGCGAGGCTTCATGGTTTCCCACGATGGCGTCCTCCTCAGTCTCCCCATAGAC
 
. : . : . : . : . : . :
JMFF042A20+ CTCATCCGTGCTGACATGAATGAACCGCTTGATCTGACCAGTAACCTTGCAGGCCTCCAA
JMFS070C09+ CTCATCCGTGCTGACATGAATGAACCGCTTGATCTGACCAGTAACCTTGCAGGCCTCCAA
JMFF042O07+ CTCATCCGTGCTGACATGAATGAACCGCTTGATCTGACCAGTAACCTTGCAGGCCTCCAA
JMFF041A16+ CTCATCCGTGCTGACATGAATGAACCGCTTGATCTGACCAGTAACCTTGCAGGCCTCCAA
JMFF027A08+ CTCATCCGTGCTGACATGAATGAACCGCTTGATCTGACCAGTAACCTTGCAGGCCTCCAA
JMFF040O12+ CTCATCCGTGCTGACATGAATGAACCGCTTGATCTGACCAGTAACCTTGCAGGCCTCCAA
                      ____________________________________________________________
consensus CTCATCCGTGCTGACATGAATGAACCGCTTGATCTGACCAGTAACCTTGCAGGCCTCCAA
 
. : . : . : . : . : . :
JMFF042A20+ GAGAACATGAGTGCCATAAATGTTGTTCTTGGTGAACTCAAAGCTGTTGCCAAAGGAGTT
JMFS070C09+ GAGAACATGAGTGCCATAAATGTTGTTCTTGGTGAACTCAAAGCTGTTGCCAAAGGAGTT
JMFF042O07+ GAGAACATGAGTGCCATAAATGTTGTTCTTGGTGAACTCAAAGCTGTTGCCAAAGGAGTT
JMFF041A16+ GAGAACATGAGTGCCATAAATGTTGTTCTTGGTGAACTCAAAGCTGTTGCCAAAGGAGTT
JMFF027A08+ GAGAACATGAGTGCCATAAATGTTGTTCTTGGTGAACTCAAAGCTGTTGCCAAAGGAGTT
JMFF040O12+ GAGAACATGAGTGCCATAAATGTTGTTCTTGGTGAACTCAAAGCTGTTGCCAAAGGAGTT
                      ____________________________________________________________
consensus GAGAACATGAGTGCCATAAATGTTGTTCTTGGTGAACTCAAAGCTGTTGCCAAAGGAGTT
 
. : . : . : . : . : . :
JMFF042A20+ GTCAACATGGGTCTGAGCTGCAAAATGCATTATGGTGTCAATGGACTCGGTGACGAGAAT
JMFS070C09+ GTCAACATGGGTCTGAGCTGCAAAATGCATTATGGTGTCAATGGACTCGGTGACGAGAAT
JMFF042O07+ GTCAACATGGGTCTGAGCTGCAAAATGCATTATGGTGTCAATGGACTCGGTGACGAGAAT
JMFF041A16+ GTCAACATGGGTCTGAGCCGCAAAATGCATTATGGTGTCAATGGACTCGGTGACGAGAAT
JMFF027A08+ GTCAACATGGGTCTGAGCTGCAAAATGCATTATGGTGTCAATGGACTCGGTGACGAGAAT
JMFF040O12+ GTCAACATGGGTCTGAGCTGCAAAATGCATTATGGTGTCAATGGACTCGGTGACGAGAAT
                      ____________________________________________________________
consensus GTCAACATGGGTCTGAGCTGCAAAATGCATTATGGTGTCAATGGACTCGGTGACGAGAAT
 
. : . : . : . : . : . :
JMFF042A20+ GTGGTTTACAAGATCAGCACTCCCGATATCTCCCTTGACAAACTTGAAGTTAGGGGACGA
JMFS070C09+ GTGGTTTACAAGATCAGCACTCCCGATATCTCCCTTGACAAACTTGAAGTTAGGGGACGA
JMFF042O07+ GTGGTTTACAAGATCAGCACTCCCGATATCTCCCTTGACAAACTTGAAGTTAGGGGACGA
JMFF041A16+ GTGGTTTACAAGATCAGCACTCCCGATATCTCCCTTGACAAACTTGAAGTTAGGGGACGA
JMFF027A08+ GTGGTTTACAAGATCAGCACTCCCGATATCTCCCTTGACAAACTTGAAGTTAGGGGACGA
JMFF040O12+ GTGGTTTACAAGATCAGCACTCCCGATATCTCCCTTGACAAACTTGAAGTTAGGGGACGA
                      ____________________________________________________________
consensus GTGGTTTACAAGATCAGCACTCCCGATATCTCCCTTGACAAACTTGAAGTTAGGGGACGA
 
. : . : . : . : . : . :
JMFF042A20+ G
JMFS070C09+ GCTCGAGGGCAGAAGGTTCTTGAGGTTTGAGCAGTAGTCAAGCTTATCAAGAACAACAAT
JMFF042O07+ GCTCGAGGGCAGAAGGTTCTTGAGGTTTGAGCAGTAGTCAAGCTTATCAAGAACAACAAT
JMFF041A16+ GCTCGAGGGCAGAAGGTTCTTGAGGTTTGAGCAGTAGTCAAGCTTATCAAGAACAACAAT
JMFF027A08+ GCTCGAGGGCAGAAGGTTCTTGAGGTTTGAGCAGTAGTCAAGCTTATCAAGAACAACAAT
JMFF040O12+ GCTCGAGGGCAGAAGGTTCTTGAGGTTTGAGCAGTAGTCAAGCTTATCAAGAACAACAAT
                      ____________________________________________________________
consensus GCTCGAGGGCAGAAGGTTCTTGAGGTTTGAGCAGTAGTCAAGCTTATCAAGAACAACAAT
 
. : . : . : . : . : . :
JMFS070C09+ CTTGTAATCTGGGTAGTTCCTGATAAGCCTGTTTGCAACATGGGATGCAATGAATCCGGC
JMFF042O07+ CTTGTAATCTGGGTAGTTCCTGATAAGCCTGTTTGCAACATGGGATGCAATGAATCCGGC
JMFF041A16+ CTTGTAATCTGGGTAGTTCCTGATAAGCCTGTTTGCAACATGGGATGCAATGAATCCGGC
JMFF027A08+ CTTGTAATCTGGGTAGTTCCTGATAAGCCTGTTTGCAACATGGGATGCAATGAATCCGGC
JMFF040O12+ CTTGTAATCTGGGTAGTTCCTGATAAGCCTGTTTGCAACATGGGATGCAATGAATCCGGC
                      ____________________________________________________________
consensus CTTGTAATCTGGGTAGTTCCTGATAAGCCTGTTTGCAACATGGGATGCAATGAATCCGGC
 
. : . : . : . : . : . :
JMFS070C09+ AGCTCCGGTGACAAGGATGTTCTTTGGGGTATAAGCTTCCATCTTAACCGAGCTTAGCTG
JMFF042O07+ AGCTCCGGTGACAAGGATGTTCTTTGGGGTATAAGCTTCCATCTTAACCGAG---AGCTG
JMFF041A16+ AGCTCCGGTGACAAGGATGTTCTTTGGGGTATAAGCTTCCATCTTAACCGAGCTTAGCTG
JMFF027A08+ AGCTCCGGTGACAAGGATGTTCTTTGGGGTATAAGCTTCCATCTTAACCGAGCTTAGCTG
JMFF040O12+ AGCTCCGGTGACAAGGATGTTCTTTGGGGTATAAGCTTCCATCTTAACCGAG---AGCTG
                      ____________________________________________________________
consensus AGCTCCGGTGACAAGGATGTTCTTTGGGGTATAAGCTTCCATCTTAACCGAGCTTAGCTG
 
. : . : . : . : . : . :
JMFS070C09+ CCTGGTGAAGTCAGCTCGGATGTGATGAGGTTGAAGAAG
JMFF042O07+ CCTGGTGAAGTCAGCTCGGATGTGATGAGGTTGAAGAAGCTAAGGAGCT
JMFF041A16+ CCTGGTGAAGTCAGCTCGGATGTGATGAGGTTGAAGAAGCTAAGGAGCT
JMFF027A08+ CCTGGTGAAGTCAGCTCGGATGTGATGAGGTTGAAGAAGCTAAGGAGCTGAGGAG
JMFF040O12+ CCTGGTGAAGTCAGCTCGGATGTGATGAGGTTGAAGAAGCTAAGGAGCTGAGGAGTGAGG
                      ____________________________________________________________
consensus CCTGGTGAAGTCAGCTCGGATGTGATGAGGTTGAAGAAGCTAAGGAGCTGAGGAGTGAGG