Previous Contig 001747:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025K19Sequence527001747 (7)gb:AP005396_18510780.010Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063596001747 (7)gb:AP005396_18510780.013Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063
JMFF026C13Sequence510001747 (7)gb:AP005396_18510780.009Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063659001747 (7)gb:AP005396_18510780.016Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063
JMFF040O10Sequence559001747 (7)gb:AP005396_18510780.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063745021599gb:AP005396_18510780.004Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063
JMFN017I13Sequence620001747 (7)gb:AP005396_18510780.024Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063
JMFN036K02Sequence590001747 (7)gb:AP005396_18510780.003Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P063

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025K19- TAATTTCNCAGCACTTTTATGTACATGGATTACAAGAATGTACCAACGTCCAAC
rJMFF026C13- TAATTTCACAGCACTTTTATGTACATGGATTACAAGAATGTACCAACGTCCAAC
                      ____________________________________________________________
consensus TAATTTCACAGCACTTTTATGTACATGGATTACAAGAATGTACCAACGTCCAAC
 
. : . : . : . : . : . :
rJMFF025K19- CTCAATCCATATATATGATGAAAAGATGGAATTAGTTGATATTGAACTTGTTCAGGTCGG
rJMFF026C13- CTCAATCCATATATATGATGAAAAGATGGAATTAGTTGATATTGAACTTGTTCAGGTCGG
JMFN017I13+ AGTTGATATTGAACTGTTTCAGGTCGG
                      ____________________________________________________________
consensus CTCAATCCATATATATGATGAAAAGATGGAATTAGTTGATATTGAACTTGTTCAGGTCGG
 
. : . : . : . : . : . :
rJMFF025K19- TCAAAATGGAGTCCGCCGCGACGCTGTAAACCGTCACCTGCTTACCCGATGTCTTTACAT
rJMFF026C13- TCAAAATGGAGTCCGCCGCGACGCTGTAAACCGTCACCTGCTTACCCGATGTCTTTACAT
JMFN017I13+ TCAAAATGGAGTCCGCCGCAACGCTGTAAACCGTCACCTGCTTACCCGATGTCTTTACAT
JMFN036K02+ GTCACCTGCTTACCCGATGTCTTTACAT
                      ____________________________________________________________
consensus TCAAAATGGAGTCCGCCGCGACGCTGTAAACCGTCACCTGCTTACCCGATGTCTTTACAT
 
. : . : . : . : . : . :
rJMFF025K19- ATTGGTCCTCAACCCCGACGGTTCCAAGCTTTTCCATACACCATCTGACGCCGTCGATGG
rJMFF026C13- ATTGGTCCTCAACCCCGACGGTTCCAAGCTTTTCCATACACCATCTGACGCCGTCGATGG
JMFN017I13+ ATTGGTCCTCAACCCCGACGGTTCCAAGCTTTTCCATACACCATCTGACGCCGTCGATGG
JMFN036K02+ ATTGGTCCTCAACCCCGACGGTTCCAAGCTTTTCCATACACCATCTGACGCCGTCGATGG
JMFF040O10+ CGATGG
                      ____________________________________________________________
consensus ATTGGTCCTCAACCCCGACGGTTCCAAGCTTTTCCATACACCATCTGACGCCGTCGATGG
 
. : . : . : . : . : . :
rJMFF025K19- AGGTCATAAGCGATAAGCTAGCGTCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
rJMFF026C13- AGGTCATAAGCGATAAGCTAGCGTCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
JMFN017I13+ AGGTCATAAGCGATAAGCTAGCGTCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
JMFN036K02+ AGGTCATAAGCGATAAGCTAGCGTCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
JMFF026C13+ TCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
JMFF025K19+ TAAGCGATAAGCTAGCGTCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
JMFF040O10+ AGGTCATAAGCGATAAGCTAGCGTCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
                      ____________________________________________________________
consensus AGGTCATAAGCGATAAGCTAGCGTCTTCGCTGGCGCCCATCTCGGACAACGCCGCGGGGT
 
. : . : . : . : . : . :
rJMFF025K19- GTTTAAGGATGTTGGCGGCCATCCTGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
rJMFF026C13- GTTTAAGGATGTTGGCGGCCATCCTGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
JMFN017I13+ GTTTAAGGATGTTGGCGGCCATCATGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
JMFN036K02+ GTTTAAGGATGTTGGCGGCCATCCTGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
JMFF026C13+ GTTTAAGGATGTTGGCGGCCATCCTGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
JMFF025K19+ GTTTAAGGATGTTGGCGGCCATCCTGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
JMFF040O10+ GTTTAAGGATGTTGGCGGCCATCCTGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
                      ____________________________________________________________
consensus GTTTAAGGATGTTGGCGGCCATCCTGAGTTGCAAGGCCGTGCTGTCCAAGAGCCTTGCGC
 
. : . : . : . : . : . :
rJMFF025K19- ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
rJMFF026C13- ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
JMFN017I13+ ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
JMFN036K02+ ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
JMFF026C13+ ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
JMFF025K19+ ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
JMFF040O10+ ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
                      ____________________________________________________________
consensus ACTCGGCATACGCCGTCTTCACGGCAGGACTCCTCGCGACCTTGTTCGCCGCGTACTTGC
 
. : . : . : . : . : . :
rJMFF025K19- GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
rJMFF026C13- GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
JMFN017I13+ GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
JMFN036K02+ GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
JMFF026C13+ GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
JMFF025K19+ GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
JMFF040O10+ GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
                      ____________________________________________________________
consensus GCATCCCCTCCGCGTTGGCCAATCCCGACTCGGCGATTGCGGCGGCCATCGACTCTTGAG
 
. : . : . : . : . : . :
rJMFF025K19- ATGATGCCGACGCGACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
rJMFF026C13- ATGATGCCGACGCGACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
JMFN017I13+ ATGATGCCGACGCGACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
JMFN036K02+ ATGATGCCGACGCAACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
JMFF026C13+ ATGATGCCGACGCGACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
JMFF025K19+ ATGATGCCGACGCGACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
JMFF040O10+ ATGATGCCGACGCAACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
                      ____________________________________________________________
consensus ATGATGCCGACGCGACTAGGGGCTCTTTCGAGAGGTGGTTGATGCAGAACTCGTGGTCGA
 
. : . : . : . : . : . :
rJMFF025K19- AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGG
rJMFF026C13- AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGGATGGTG
JMFN017I13+ AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGGATGGTG
JMFN036K02+ AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGGATGGTG
JMFF026C13+ AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGGATGGTG
JMFF025K19+ AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGGATGGTG
JMFF040O10+ AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGGATGGTG
                      ____________________________________________________________
consensus AGGTATTGTTGCAGGCTCTTTGGATGAGGGTGAGGTTTAAAGGAGAGGCTGTGGATGGTG
 
. : . : . : . : . : . :
rJMFF026C13- AAACCATCGAGAGGAAACATAAAAGAGTGCCAATATTCATAAGGGAAACCATAACATTAT
JMFN017I13+ AAACCATCGAGAGGAAACATAAAAGAGTGCCAATATTCATAAGGGAAACCATAACATTAT
JMFN036K02+ AAACCATCGAGAGGAAACATAAAAGAGTGCCAATATTTATAAGGGAAACCATAACATTAT
JMFF026C13+ AAACCATCGAGAGGAAACATAAAAGAGTGCCAATATTCATAAGGGAAACCATAACATTAT
JMFF025K19+ AAACCATCGAGAGGAAACATAAAAGAGTGCCAATATTCATAAGGGAAACCATAACATTAT
JMFF040O10+ AAACCATCGAGAGGAAACATAAAAGAGTGCCAATATTCATAAGGGAAACCATAACATTAT
                      ____________________________________________________________
consensus AAACCATCGAGAGGAAACATAAAAGAGTGCCAATATTCATAAGGGAAACCATAACATTAT
 
. : . : . : . : . : . :
rJMFF026C13- TTGTT
JMFN017I13+ TTGTTAAAGAACCNCATGTTATTGGGGAATAGATTGATTGGCAAGAAAGGGTA
JMFN036K02+ TTGTTAAAGAACC-CATGTTATTGGGGAATAGATTGATTGGCAAGAAAGGGTACAAATAT
JMFF026C13+ TTGTTAAAGAACC-CATGTTATTGGGGAATAGATTGATTGGCAAGAAAGGGTACAAATAT
JMFF025K19+ TTGTTAAAGAACC-CATGTTATTGGGGAATAGATTGATTGGCAAGAAAGGGTACAAATAT
JMFF040O10+ TTGTTAAAGAACC-CATGTTATTGGGGAATAGATTGATTGGCAAGAAAGGGTACAAATAT
                      ____________________________________________________________
consensus TTGTTAAAGAACC-CATGTTATTGGGGAATAGATTGATTGGCAAGAAAGGGTACAAATAT
 
. : . : . : . : . : . :
JMFN036K02+ ATTATTAAAGAGTGTGCCCTTCC
JMFF026C13+ ATTATTAAAGAGTGTGCCCTTCCAAGCTAGATAATGTTTCCTCGACGTTGGCTT
JMFF025K19+ ATTATTAAAGAGTGTGCCCTTCCAAGCTAGATAATGTTTCCTCGACGTTGGCTT
JMFF040O10+ ATTATTAAAGAGTGTGCCCTTCCAAGCTAGATAATGTTTCCTCGACGTTGGCTTCCCACA
                      ____________________________________________________________
consensus ATTATTAAAGAGTGTGCCCTTCCAAGCTAGATAATGTTTCCTCGACGTTGGCTTCCCACA