Previous Contig 001741:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035P10Sequence434001741 (9)468001741 (9)
JMFF039E14Sequence485001741 (9)
JMFF040M04Sequence510001741 (9)651001741 (9)
JMFN019B13Sequence627001741 (9)gb:BA000031_7068510.042Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence.
JMFN019F17Sequence622001741 (9)
JMFN029C24Sequence400001741 (9)
JMFS072C05Sequence627001741 (9)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF035P10- ATTCTTCACAATAAATCAAGAGTAATTATACAACAACATACATGATGGT
rJMFF040M04- AATAAATCAAGAGTAATTATACAACAACATACATGATGGT
                      ____________________________________________________________
consensus ATTCTTCACAATAAATCAAGAGTAATTATACAACAACATACATGATGGT
 
. : . : . : . : . : . :
rJMFF035P10- AATAATCACCACAGCCAACATTTAGGAAATGAAGGG---AATAATTTTCCTCTCACTACC
rJMFF039E14- AGCCAACATTTAGGAAATGAAGGGAACAATAATTTTCCTCTCACTACC
rJMFF040M04- AATAATCACCACAGCCAACATTTAGGAAATGAAGGG---AATAATTTTCCTCTCACTACC
                      ____________________________________________________________
consensus AATAATCACCACAGCCAACATTTAGGAAATGAAGGG---AATAATTTTCCTCTCACTACC
 
. : . : . : . : . : . :
rJMFF035P10- CATTATAATTACTCTTTCACCACAAAACACACCCTATTAAATTAATGGGCAATACCATGG
rJMFF039E14- CATTATAATTACTCTTTCACCACAAAACACACCTTATTAAATTAATGGGCAATACTATAG
rJMFF040M04- CATTATAATTACTCTTTCACCACAAAACACACCCTATTAAATTAATGGGCAATACCATGG
                      ____________________________________________________________
consensus CATTATAATTACTCTTTCACCACAAAACACACCCTATTAAATTAATGGGCAATACCATGG
 
. : . : . : . : . : . :
rJMFF035P10- AGTTGATCTACAAACGCAATCGCCACCATATCCGCTCTTAAAGATTCCACTGCCTTGATT
rJMFF039E14- AAGTGTTCCACAAACTTAATGGCCACCATATCCGCTCTTAAAGATTCCACCGCCTTCGTG
rJMFF040M04- AGTTGATCTACAAACGCAATCGCCACCATATCCGCTCTTAAAGATTCCACTGCCTTGATT
JMFN019B13+ ACAAACGCAATCGCCACCATATCCGCCCTTAAAGATTCCACTGCCTTCATT
JMFS072C05+ ACAAACGCAATCGCCACCATATCCGCTCTTAAAGATTCCACTGCCTTGATT
JMFN019F17+ ACAAACGCAATCGCCACCATATCCGCTCTTAAAGATTCCACTGCCTTGATT
                      ____________________________________________________________
consensus AGTTGATCTACAAACGCAATCGCCACCATATCCGCTCTTAAAGATTCCACTGCCTTGATT
 
. : . : . : . : . : . :
rJMFF035P10- TGCAACTCTAACCACACACCGCTTTGTCTTCCAACGGTAGAGAAATTGCAATGCTCCTTC
rJMFF039E14- TGCAACTCTAACCACACACCG---TGTCTTCCGGCAGTAGAGAA---GCACTCCTCCTTC
rJMFF040M04- TGCAACTCTAACCACACACCGCTTTGTCTTCCAACGGTAGAGAAATTGCAATGCTCCTTC
JMFN019B13+ TGCAACTCTAACCACACACCACTTTGTCTTCCGGCGATAGAGAAATTGCAATGCTCCTTC
JMFS072C05+ TGCAACTCTAACCACACACCGCTTTGTCTTCCAACGGTAGAGAAATTGCAATGCTCCTTC
JMFN019F17+ TGCAACTCTAACCACACACCGCTTTGTCTTCCAACGGTAGAGAAATTGCAATGCTCCTTC
                      ____________________________________________________________
consensus TGCAACTCTAACCACACACCGCTTTGTCTTCCAACGGTAGAGAAATTGCAATGCTCCTTC
 
. : . : . : . : . : . :
rJMFF035P10- ATTGCCGCTTTTCCATCCTCCCCACTCAACTCCACATTGGAATCAGTGGAAGGCTCCTTT
rJMFF039E14- ACCGCCGCTTTTCCATCCACCCCTTTCAAATCCACAATGANATCGGTGGAAGGCTTCTTT
rJMFF040M04- ATTGCCGCTTTTCCATCCTCCCCACTCAACTCCACATTGGAATCAGTGGAAGGCTCCTTT
JMFN019B13+ ATTGCCGCTTTTCCATCCACCCCATTCAAATCCACAATGGAATCGCTGGAAGGCTCCTTT
JMFS072C05+ ATTGCCGCTTTTCCATCCTCCCCACTCAACTCCACATTGGAATCAGTGGAAGGCTCCTTT
JMFN019F17+ ATTGCCGCTTTTCCATCCTCCCCACTCAACTCCACATTGGAATCAGTGGAAGGCTCCTTT
JMFF040M04+ ACTCCACATTGGAATCAGTGGAAGGCTCCTTT
                      ____________________________________________________________
consensus ATTGCCGCTTTTCCATCCTCCCCACTCAACTCCACATTGGAATCAGTGGAAGGCTCCTTT
 
. : . : . : . : . : . :
rJMFF035P10- ACTAAAGCATTGCTAAAGGTTTTCTCGGTTGAACCAACCACCTTATTTATAAATCCCCAG
rJMFF039E14- TCTANAGCATTGCTAAACGAATTCTCGCTTGAACTAACCACGTTGTTTATATATCTCCAG
rJMFF040M04- ACTAAAGCATTGCTAAAGGTTTTCTCGGTTGAACCAACCACCTTATTTATAAATCCCCAG
JMFN019B13+ ACTAAAGCATTGCTAAATGTTTCCTCAGTTGAACTAACCACCTTGTTTATAAATCCCCAG
JMFS072C05+ ACTAAAGCATTGCTAAAGGTTTTCTCGGTTGAACCAACCACCTTATTTATAAATCCCCAG
JMFN019F17+ ACTAAAGCATTGCTAAAGGTTTTCTCGGTTGAACCAACCACCTTATTTATAAATCCCCAG
JMFF035P10+ CTTATTTATAAATCCCCAG
JMFF040M04+ ACTAAAGCATTGCTAAAGGTTTTCTCGGTTGAACCAACCACCTTATTTATAAATCCCCAG
                      ____________________________________________________________
consensus ACTAAAGCATTGCTAAAGGTTTTCTCGGTTGAACCAACCACCTTATTTATAAATCCCCAG
 
. : . : . : . : . : . :
rJMFF035P10- CACTTCTTAAAATCTTGGACGTCTTTTACACTCAAAGACTTTTCGCTATTTATCTTTTTC
rJMFF039E14- CACCTCTTAAAATCTTGGACCTCTTTTGCACTCAAAGACTTTTCGTTATTTATCTTTTTC
rJMFF040M04- CACTTCTTAAAATCTTGGACGTCTTTTACACTCAAAGACTTTTCGCTATTTATCTTTTTC
JMFN019B13+ CACCTCTTAAAATCTTGGACCTCTTTTGCACTCAAAGACTTTTCGCTATTTATCTTTTTC
JMFS072C05+ CACTTCTTAAAATCTTGGACGTCTTTTACACTCAAAGACTTTTCGCTATTTATCTTTTTC
JMFN019F17+ CACTTCTTAAAATCTTGGACGTCTTTTACACTCAAAGACTTTTCGCTATTTATCTTTTTC
JMFN029C24+ TCTTTTGCACTCAAAGACTTTTCGTTATGTATCTTTTTC
JMFF035P10+ CACTTCTTAAAATCTTGGACGTCTTTTACACTCAAAGACTTTTCGCTATTTATCTTTTTC
JMFF040M04+ CACTTCTTAAAATCTTGGACGTCTTTTACACTCAAAGACTTTTCGCTATTTATCTTTTTC
                      ____________________________________________________________
consensus CACTTCTTAAAATCTTGGACGTCTTTTACACTCAAAGACTTTTCGCTATTTATCTTTTTC
 
. : . : . : . : . : . :
rJMFF035P10- TC
rJMFF039E14- TCCAAAGCCTCGAAGGCTTTGACTTTGTTGTGGACTTCCTTTAAGACAACA-GCCACGAA
rJMFF040M04- TCCAAAGCTTCGAAGGCTTTGATTTTGTTGTGGGCTTCCTTTAAGACGACA-GCCACGGT
JMFN019B13+ TCCAAAGCCTCGAAAGCTCTGACTTTGTTGTGGGCTTCCTTTAAGACGACA-GCCACGGT
JMFS072C05+ TCCAAAGCTTCGAAGGCTTTGATTTTGTTGTGGGCTTCCTTTAAGACGACA-GCCACGGT
JMFN019F17+ TCCAAAGCTTCGAAGGCTTTGATTTTGTTGTGGGCTTCCTTTAAGACGACA-GCCACGGT
JMFN029C24+ TCCAAAGCCTCGAAGGCTTTGACTTTGTTGTGGACTTCCTTTAAGACAACAGGCCACGAA
JMFF035P10+ TCCAAAGCTTCGAAGGCTTTGATTTTGTTGTGGGCTTCCTTTAAGACGACA-GCCACGGT
JMFF040M04+ TCCAAAGCTTCGAAGGCTTTGATTTTGTTGTGGGCTTCCTTTAAGACGACA-GCCACGGT
                      ____________________________________________________________
consensus TCCAAAGCTTCGAAGGCTTTGATTTTGTTGTGGGCTTCCTTTAAGACGACA-GCCACGGT
 
. : . : . : . : . : . :
rJMFF039E14- ATTTCTCCTATCA
rJMFF040M04- TTTTCTCCTATCAGAAGTAGCGAGGAAGGCAGCTCTGTGGCCGA-GTAAATCGCGAGCGC
JMFN019B13+ CTTTCTCCTATCACAAGTAGCGAGAAAGGCAGCTCTGTGGCCGA-GTAAATCACGAGCGC
JMFS072C05+ TTTTCTCCTATCAGAAGTAGCGAGGAAGGCAGCTCTGTGGCCGA-GTAAATCGCGAGCGC
JMFN019F17+ TTTTCTCCTATCAGAAGTAGCGAGGAAGGCAGCTCTGTGGCCGA-GTAAATCGCGAGCGC
JMFN029C24+ ATTTCTCCTATCACAAGTAGCGAGGAAGGCAGCTCTGTGGCCGAGGTAAATGGCGAGCGC
JMFF035P10+ TTTTCTCCTATCAGAAGTAGCGAGGAAGGCAGCTCTGTGGCCGA-GTAAATCGCGAGCGC
JMFF040M04+ TTTTCTCCTATCAGAAGTAGCGAGGAAGGCAGCTCTGTGGCCGA-GTAAATCGCGAGCGC
                      ____________________________________________________________
consensus TTTTCTCCTATCAGAAGTAGCGAGGAAGGCAGCTCTGTGGCCGA-GTAAATCGCGAGCGC
 
. : . : . : . : . : . :
rJMFF040M04- AAAATATGACCATGCTAGAGTCATCTCGACCGAGGGCTTCAGTGCATTTCTTAAGGAGTA
JMFN019B13+ AAAATATGACCAAGTTTGAGTCATCTCGACCAAGGGCTTTGGTGCATTTATTGAGGAGTA
JMFS072C05+ AAAATATGACCATGCTAGAGTCATCTCGACCGAGGGCTTCAGTGCATTTCTTAAGGAGTA
JMFN019F17+ AAAATATGACCATGCTAGAGTCATCTCGACCGAGGGCTTCAGTGCATTTCTTAAGGAGTA
JMFN029C24+ AAAATGTGACCAGCTCGGAGTCATCTGGACCGAGGGCTTCAATGCATTTGTTAAAGATTA
JMFF035P10+ AAAATATGACCATGCTAGAGTCATCTCGACCGAGGGCTTCAGTGCATTTCTTAAGGAGTA
JMFF040M04+ AAAATATGACCATGCTAGAGTCATCTCGACCGAGGGCTTCAGTGCATTTCTTAAGGAGTA
                      ____________________________________________________________
consensus AAAATATGACCATGCTAGAGTCATCTCGACCGAGGGCTTCAGTGCATTTCTTAAGGAGTA
 
. : . : . : . : . : . :
rJMFF040M04- NGGTTTTATGGTCAGA
JMFN019B13+ GGGTTTTGTGGTCGGAGGGAGGTGGACGGTGGGCAACCGCTGTAGTGGCGGTGGTGAATG
JMFS072C05+ GGGTTTTATGGTCAGAGGGAGGTGGACGGTGCGCAACAGCCGTAGTGGCGATGGTGAATG
JMFN019F17+ GGGTTTTATGGTCAGAGGGAGGTGGACGGTGCGCAACAGCCGTAGTGGCGATGGTGAATG
JMFN029C24+ GGGTTTTCTCATCAGAGGGAGGTGAACGGTGCACAACCGCCATAGTGGCGGTGGTG
JMFF035P10+ GGGTTTTATGGTCAGAGGGAGGTGGACGGTGCGCAACAGCCGTAGTGGCGATGGTG
JMFF040M04+ GGGTTTTATGGTCAGAGGGAGGTGGACGGTGCGCAACAGCCGTAGTGGCGATGGTGAATG
                      ____________________________________________________________
consensus GGGTTTTATGGTCAGAGGGAGGTGGACGGTGCGCAACAGCCGTAGTGGCGATGGTGAATG
 
. : . : . : . : . : . :
JMFN019B13+ CCACAACCAGGATGAGGAGGATAGATGGAGGGACGGCGGTGGCGGCCATGTTATTAGATA
JMFS072C05+ CCACAACAAGGATGAGGAGGATAGATGGAGGGGCGGCTGTGGCGGCCATGTTATTAGATA
JMFN019F17+ CCACAACAAGGATGAGGAGGATAGATGGAGGGGCGGCTGTGGCGGCCATGTTATTAGATA
JMFF040M04+ CCACAACAAGGATGAGGAGGATAGATGGAGGGGCGGCTGTGGCGGCCATGTTATTAGATA
                      ____________________________________________________________
consensus CCACAACAAGGATGAGGAGGATAGATGGAGGGGCGGCTGTGGCGGCCATGTTATTAGATA
 
. : . : . : . : . : . :
JMFN019B13+ GAGATATGGGTTGTTTAAGTGTGGC
JMFS072C05+ GAGATATGGGTTGTTTAAGTGTGGCAGATATAA
JMFN019F17+ GAGATATGGGTTGTTTAAGTGTGGCAGATATAA
JMFF040M04+ GAGATATGGGTTGTTTAAGTGTGGCAGATATAAGATAATGTTGTGTGGAGAATAGATGAT
                      ____________________________________________________________
consensus GAGATATGGGTTGTTTAAGTGTGGCAGATATAAGATAATGTTGTGTGGAGAATAGATGAT