Previous Contig 001738:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008P22Sequence620001738 (33)gb:AY084696_15697831e-35Arabidopsis thaliana clone 11537 mRNA, complete sequence.665001738 (33)gb:AY084696_15697831e-40Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFF011A05Sequence461001738 (33)gb:ATAC009400_15429716e-17Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen699001738 (33)gb:AY084696_15697836e-41Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFF015M10Sequence590001738 (33)gb:ATAC009400_15429715e-23Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen703001738 (33)gb:AY084696_15697837e-41Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFF015M21Sequence289001738 (33)471001738 (33)gb:AY084696_15697831e-19Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFF036I13Sequence545001738 (33)gb:ATAC009400_15429711e-22Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen696001738 (33)gb:AY084696_15697836e-41Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFF039H17Sequence148001738 (33)192001738 (33)
JMFF039M14Sequence526001738 (33)gb:ATAC009400_15429715e-22Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen713001738 (33)gb:AY084696_15697836e-41Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFF040L11Sequence607001738 (33)gb:ATAC009400_15429718e-22Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen758001738 (33)gb:ATAC009400_15429711e-43Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFF042E17Sequence656001738 (33)gb:ATAC009400_15429716e-36Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen621001738 (33)gb:ATAC009400_15429714e-31Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFF044G19Sequence641001738 (33)gb:ATAC009400_15429716e-36Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen590001738 (33)gb:ATAC009400_15429718e-24Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFF046H12Sequence434001738 (33)gb:ATAC009400_15429712e-14Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen454001738 (33)gb:AY084696_15697832e-14Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFF051P17Sequence632001738 (33)gb:ATAC009400_15429713e-34Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen548001738 (33)gb:AY084696_15697835e-23Arabidopsis thaliana clone 11537 mRNA, complete sequence.
JMFN005O21Sequence626001738 (33)gb:ATAC009400_15429716e-36Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFN014G21Sequence615001738 (33)gb:ATAC009400_15429713e-35Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFN016H03Sequence609001738 (33)gb:ATAC009400_15429718e-32Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFN019A11Sequence614001738 (33)gb:ATAC009400_15429716e-36Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFN028D22Sequence631001738 (33)gb:ATAC009400_15429711e-35Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMFN040C19Sequence629001738 (33)gb:ATAC009400_15429716e-25Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen
JMSF013G11Sequence440001738 (33)gb:ATAC009400_15429712e-15Arabidopsis thaliana chromosome III BAC F14P13 genomic sequence, complete sequen739011739 (3)gb:AY292526_15956373e-46Ginkgo biloba chlorophyllase (CLH) mRNA, complete cds.
JMSF019K14Sequence243001738 (33)765001738 (33)gb:AY084696_15697834e-43Arabidopsis thaliana clone 11537 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046H12- CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTGAAATAC
rJMFF044G19- TTGAAATAC
rJMFF051P17- TTGAAATAC
rJMFF042E17- TTGAAATAC
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTTGAAATAC
 
. : . : . : . : . : . :
rJMFF046H12- TGTAATATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF044G19- TGTAATATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF051P17- TGTAATATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF042E17- TGTAATATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF015M10- GTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF036I13- GTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF008P22- GGCAGAAGTGGCGGA
rJMFF015M21- TATAGACAAGGGCAGAAGTGGNAGA
rJMFF039H17- AGACAAGGGCAGAAGTGGCAGA
JMFN016H03+ ATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF039M14- ATATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF011A05- GGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMFF040L11- ATATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
rJMSF019K14- ATATAGACAAGGGCAGAAGTGGCAGA
                      ____________________________________________________________
consensus TGTAATATTCAGTTGATTGGTGGAAATCCAGTACATATAGACAAGGGCAGAAGTGGCAGA
 
. : . : . : . : . : . :
rJMFF046H12- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF044G19- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF051P17- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF042E17- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF015M10- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF036I13- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF008P22- GTTGAANGTTGAAACCACTTCTCACTGAAGATGCATCTGGTANTTTCGATCCCGTTTCTT
rJMFF015M21- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF039H17- GTTGANAGTTGAAACCNCTTCTCACTGANGATGCATCTGGTAGTTTCGATCCNGTTTCTT
JMFN016H03+ GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF039M14- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMFF011A05- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTGTT
rJMFF040L11- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
rJMSF019K14- GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
                      ____________________________________________________________
consensus GTTGAAAGTTGAAACCACTTCTCACTGAAGATGCATCTGGTAGTTTCGATCCCGTTTCTT
 
. : . : . : . : . : . :
rJMFF046H12- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF044G19- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF051P17- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF042E17- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF015M10- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF036I13- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF008P22- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF015M21- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF039H17- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACGAATATCAGTGACCC
JMFN016H03+ ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF039M14- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF011A05- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMFF040L11- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
rJMSF019K14- ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
                      ____________________________________________________________
consensus ACGAAGATCCGAACCCGATTTCTAATTAACTCCCGACCCGATTACAAATATCAGTGACCC
 
. : . : . : . : . : . :
rJMFF046H12- GCATGTTCCAAAAGAAGAAGAAAAAGAAAATCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF044G19- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF051P17- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF042E17- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF015M10- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF036I13- GCATGTTCCAAAAGAAGAAGAAAAAGAAAATCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF008P22- GCATGTTCCANAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF015M21- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF039H17- GCNTGTTCCAAAAGAAGAANAAAAAGAAACTCTGTTTTGTTTTCATCCAA
JMFN016H03+ GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF039M14- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF011A05- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMFF040L11- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
rJMSF019K14- GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
JMFF008P22+ AAATCAAGATNG
                      ____________________________________________________________
consensus GCATGTTCCAAAAGAAGAAGAAAAAGAAACTCTGTTTTGTTTTCATCCAAATCAAGATCG
 
. : . : . : . : . : . :
rJMFF046H12- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF044G19- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF051P17- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF042E17- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF015M10- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF036I13- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF008P22- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF015M21- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
JMFN016H03+ AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF039M14- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF011A05- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMFF040L11- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
rJMSF019K14- AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
JMFF008P22+ AACAGTCATCTNTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
JMFF042E17+ AGCCG
                      ____________________________________________________________
consensus AACAGTCATCTCTGCTGCTGCTCCATCATACGGCAGAAGTCCTCAAAGCATACGAAGCCG
 
. : . : . : . : . : . :
rJMFF046H12- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF044G19- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF051P17- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF042E17- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF015M10- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF036I13- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF008P22- TCGCCATTGTTATCGACCCCNAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF015M21- TCGCCATTGTTATCGACCCCNAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFN016H03+ TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF039M14- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF011A05- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMFF040L11- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
rJMSF019K14- TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFF008P22+ TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFF044G19+ ATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFF051P17+ AAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFN028D22+ TATCGACCCAAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFN005O21+ TTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFN019A11+ ATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFN014G21+ CGACCNCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
JMFF042E17+ TCGCC-ATGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
                      ____________________________________________________________
consensus TCGCCATTGTTATCGACCCCAAGTATCATGCGCCGGCAGTCCTCTAACGTGCACCGCGAG
 
. : . : . : . : . : . :
rJMFF046H12- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCT
rJMFF044G19- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF051P17- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF042E17- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF015M10- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF036I13- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF008P22- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF015M21- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFN016H03+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF039M14- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF011A05- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMFF040L11- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
rJMSF019K14- TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFF008P22+ TCGCCCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFF044G19+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFF051P17+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFN028D22+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFN005O21+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFN019A11+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFN014G21+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFF015M10+ CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFF042E17+ TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFF039M14+ CGTCGTGATC
JMFF036I13+ CCCGTCGTGATC
JMFN040C19+ TTTGAACACG-TAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
JMFF040L11+ GTCGTGATC
                      ____________________________________________________________
consensus TCG-CCGATCGTTTTGAACACGTTAAACAGCTCCTCCGCGGATATCTTCCCGTCGTGATC
 
. : . : . : . : . : . :
rJMFF044G19- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF051P17- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF042E17- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF015M10- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF036I13- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF008P22- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF015M21- CGTATCNAAGAAGTCGAAGGCGTCTCGCAGGTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFN016H03+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF039M14- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF011A05- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMFF040L11- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
rJMSF019K14- CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF008P22+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF044G19+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF051P17+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFN028D22+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFN005O21+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFN019A11+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFN014G21+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF015M10+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF042E17+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF039M14+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF036I13+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFN040C19+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
JMFF040L11+ CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
                      ____________________________________________________________
consensus CGTATCGAAGAAGTCGAAGGCGTCTCGCAGCTCGGAGTCGCAAGACGGTGGGGCGAAGGC
 
. : . : . : . : . : . :
rJMFF044G19- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCA
rJMFF051P17- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGCCGCCGTCCCTAT
rJMFF042E17- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMFF015M10- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMFF036I13- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMFF008P22- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMFF015M21- GGAGCTGAGCACGCTGAACT-CCTCGAG
JMFN016H03+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMFF039M14- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMFF011A05- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMFF040L11- GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
rJMSF019K14- GGAGCTGAGCACGCTGAACT-CCTAGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF008P22+ GGAGCTGAGCACGCTGAACTCCCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF044G19+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF051P17+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGCCGCCGTCCCTATCCACCT
JMFN028D22+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFN005O21+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFN019A11+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFN014G21+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMSF013G11- CTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF015M10+ GGAGCTGAGCACGCTGAACTCCCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF042E17+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF039M14+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF046H12+ GTCGCCGTCCCTATCCACCT
JMFF036I13+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF011A05+ GCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFN040C19+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
JMFF040L11+ GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
                      ____________________________________________________________
consensus GGAGCTGAGCACGCTGAACT-CCTCGAGGCTAATGCAACCGTCGCCGTCCCTATCCACCT
 
. : . : . : . : . : . :
rJMFF042E17- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
rJMFF015M10- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
rJMFF036I13- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
rJMFF008P22- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFN016H03+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
rJMFF039M14- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
rJMFF011A05- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
rJMFF040L11- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
rJMSF019K14- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF008P22+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF044G19+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF051P17+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFN028D22+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFN005O21+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFN019A11+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFN014G21+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMSF013G11- CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF015M10+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF042E17+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF039M14+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF046H12+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF036I13+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF011A05+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFN040C19+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
JMFF040L11+ CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
                      ____________________________________________________________
consensus CGCTCAACATCAACCTCAGCTCCTCCCTGCTGGGCGGCTCGGCTCCCACCTGGCTCAACA
 
. : . : . : . : . : . :
rJMFF042E17- GCGCCTC
rJMFF015M10- GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
rJMFF036I13- GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
rJMFF008P22- GCGNCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFN016H03+ GCGCCTCCAGCTCCTCT
rJMFF039M14- GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
rJMFF011A05- GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
rJMFF040L11- GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
rJMSF019K14- GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF008P22+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF044G19+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF051P17+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFN028D22+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFN005O21+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFN019A11+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFN014G21+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMSF013G11- GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF015M10+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF042E17+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF039M14+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF046H12+ GCGCCTCCAGCTCCTCTTTCCTGATCTNACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF036I13+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF011A05+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFN040C19+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
JMFF040L11+ GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
                      ____________________________________________________________
consensus GCGCCTCCAGCTCCTCTTTCCTGATCTTACCGTCATCGTCCCTGTCGATCAGCTTGAACG
 
. : . : . : . : . : . :
rJMFF015M10- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTCGGGGGGAGATCTCGTCGTT
rJMFF036I13- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGA
rJMFF008P22- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-NGGGGAGATCTCGTC
rJMFF039M14- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
rJMFF011A05- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
rJMFF040L11- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
rJMSF019K14- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF008P22+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF044G19+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF051P17+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFN028D22+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFN005O21+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFN019A11+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFN014G21+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMSF013G11- CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF015M21+ CAGCTNGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF015M10+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF042E17+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF039M14+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF046H12+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF036I13+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF011A05+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMSF019K14+ GTTGAGC
JMFN040C19+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
JMFF040L11+ CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
                      ____________________________________________________________
consensus CCTGGACCAGCTCGGCGTACAGCCCAGACAACTCGTC-GGGGGAGATCTCGTCGTTGAGC
 
. : . : . : . : . : . :
rJMFF040L11- GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTT
rJMSF019K14- GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF008P22+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF044G19+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF051P17+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFN028D22+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFN005O21+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFN019A11+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFN014G21+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMSF013G11- GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF015M21+ GCGGGGAGGNCGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF015M10+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF042E17+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF039M14+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF046H12+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF036I13+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF011A05+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMSF019K14+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFN040C19+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
JMFF040L11+ GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
                      ____________________________________________________________
consensus GCGGGGAGGACGCTGGTGGGCGTGGATTCTCCGCCGGGCTTCTTGTACCCGGTTTGAGAC
 
. : . : . : . : . : . :
rJMSF019K14- TCAGAATCGGAAGCGGAGGACG
JMFF008P22+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF044G19+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF051P17+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFN028D22+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFN005O21+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFN019A11+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFN014G21+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMSF013G11- TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF015M21+ TCAGAATCGGAAGCGGAGGANGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF039H17+ GACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF015M10+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF042E17+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF039M14+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF046H12+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF036I13+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF011A05+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMSF019K14+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFN040C19+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
JMFF040L11+ TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
                      ____________________________________________________________
consensus TCAGAATCGGAAGCGGAGGACGACGACGACGACGTCGTTCCGGACCTAACAGACGGCGGA
 
. : . : . : . : . : . :
JMFF008P22+ TCGTCGGAT
JMFF044G19+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF051P17+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFN028D22+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFN005O21+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFN019A11+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFN014G21+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMSF013G11- TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF015M21+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF039H17+ TCGTNGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF015M10+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF042E17+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF039M14+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF046H12+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF036I13+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF011A05+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACTCGGTCTGGGC
JMSF019K14+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFN040C19+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
JMFF040L11+ TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
                      ____________________________________________________________
consensus TCGTCGGATCTGGACAATGAACGTGATCTTAAGGATTTAAAGAGCTTACCCGGTCTGGGC
 
. : . : . : . : . : . :
JMFF044G19+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGT
JMFF051P17+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGT
JMFN028D22+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGA
JMFN005O21+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGA
JMFN019A11+ ATCTTCATGGCGAAAGAGAAAGAGGAGA
JMFN014G21+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGAT
JMSF013G11- ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGA
JMFF015M21+ ATNTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGG
JMFF039H17+ ATCTTCATGGNGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGG
JMFF015M10+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGG
JMFF042E17+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGT
JMFF039M14+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAG
JMFF046H12+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGT
JMFF036I13+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGT
JMFF011A05+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGT
JMSF019K14+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGT
JMFN040C19+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGTGGGTT
JMFF040L11+ ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGTGGGTT
                      ____________________________________________________________
consensus ATCTTCATGGCGAAAGAGAAAGAGGAGAGATGAGAGAGAAAGAAAGAAGAATGGTGGGTT
 
. : . : . : . : . : . :
JMFN040C19+ GTTGAGCGGAAGAGAGAGGTTTAAATGGGAGAGAAGT
JMFF040L11+ GTTGAGCGGAAGAGAGAGGTTTAAATGGGAGAGAAGTGAAGGGAGGCATAGTGAGCTTCC
                      ____________________________________________________________
consensus GTTGAGCGGAAGAGAGAGGTTTAAATGGGAGAGAAGTGAAGGGAGGCATAGTGAGCTTCC