Previous Contig 001737:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030H05Sequence503001737 (3)pir|A84773|A847732e-27hypothetical protein At2g35790 [imported] - Arabidopsis thaliana>gb:AC006068_153655001737 (3)gb:AC120506_17397758e-54Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0006O08 map S151
JMFF040L10Sequence532001737 (3)pir|A84773|A847731e-27hypothetical protein At2g35790 [imported] - Arabidopsis thaliana>gb:AC006068_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF030H05- TTGAA
                      ____________________________________________________________
consensus TTGAA
 
. : . : . : . : . : . :
rJMFF030H05- TAGCAAATATGAAATATCCAATCCAGGGAGATGATCTATGCCTAGGAATATATGAAAATC
                      ____________________________________________________________
consensus TAGCAAATATGAAATATCCAATCCAGGGAGATGATCTATGCCTAGGAATATATGAAAATC
 
. : . : . : . : . : . :
rJMFF030H05- AGCTCTAACACAGTAAAAACTGCAAACAAATAGGCTCTTGCCACTGTTTCTGGTACAATC
                      ____________________________________________________________
consensus AGCTCTAACACAGTAAAAACTGCAAACAAATAGGCTCTTGCCACTGTTTCTGGTACAATC
 
. : . : . : . : . : . :
rJMFF030H05- TCGAGCCAAAAGAAAGAGATGCAGTCATTTTATGCCAATATTTTTATGAAATGTCTCATT
                      ____________________________________________________________
consensus TCGAGCCAAAAGAAAGAGATGCAGTCATTTTATGCCAATATTTTTATGAAATGTCTCATT
 
. : . : . : . : . : . :
rJMFF030H05- AGTACCTTTATCAACAAAACTGATCTCCAAAGTACTGGGAGGAAGCCTCAAGGGTAGAGA
                      ____________________________________________________________
consensus AGTACCTTTATCAACAAAACTGATCTCCAAAGTACTGGGAGGAAGCCTCAAGGGTAGAGA
 
. : . : . : . : . : . :
rJMFF030H05- TGCTCACTACAAGTTCTTGAAGGCTGAATCGTGAGATGGTTTATTCGGTGTTAACTTTGC
                      ____________________________________________________________
consensus TGCTCACTACAAGTTCTTGAAGGCTGAATCGTGAGATGGTTTATTCGGTGTTAACTTTGC
 
. : . : . : . : . : . :
rJMFF030H05- TAACAATGCCTTGTTATGACAATGCTCCGTGTCGACAAAATAAAAGCTCCCATTGGCCTT
                      ____________________________________________________________
consensus TAACAATGCCTTGTTATGACAATGCTCCGTGTCGACAAAATAAAAGCTCCCATTGGCCTT
 
. : . : . : . : . : . :
rJMFF030H05- GAATGTCACGAATGGTCTATTTGTCTGCTGGCTTGATATCTGCAAATTTGATAGTTCTTG
                      ____________________________________________________________
consensus GAATGTCACGAATGGTCTATTTGTCTGCTGGCTTGATATCTGCAAATTTGATAGTTCTTG
 
. : . : . : . : . : . :
rJMFF030H05- GAATATATGTTGCCAGCCATGACATCATCTCCACCTCAAAACTGTCCGAGCCAGGCTGCC
                      ____________________________________________________________
consensus GAATATATGTTGCCAGCCATGACATCATCTCCACCTCAAAACTGTCCGAGCCAGGCTGCC
 
. : . : . : . : . : . :
rJMFF030H05- ACCTGAGTTTGTGAATGTAGGGGCTCACGAACCAGTGAAGGGCCCCAGTCGTAGTAGCGC
JMFF030H05+ GAACCAGTGAAGGGCCCCAGTCGTAGTAGCGC
JMFF040L10+ TTGTGAATGTAGGGGCTCACGAACCAGTGAAGGGCCCCAGTCGTAGTAGCGC
                      ____________________________________________________________
consensus ACCTGAGTTTGTGAATGTAGGGGCTCACGAACCAGTGAAGGGCCCCAGTCGTAGTAGCGC
 
. : . : . : . : . : . :
rJMFF030H05- TCAAGAATATGACGGTGGATGCCACCGCTCCC-TTCAGGATCACATTCATGTCGGGAGAT
JMFF030H05+ TCAAGAATATGACGGTGGATGCCACCGCTCCC-TTCAGGATCACATTCATGTCGGGAGAT
JMFF040L10+ TCAAGAATATGACGGTGGATGCCACCGCTCCCTTTCAGGATCACATTCATGTCGGGAGAT
                      ____________________________________________________________
consensus TCAAGAATATGACGGTGGATGCCACCGCTCCC-TTCAGGATCACATTCATGTCGGGAGAT
 
. : . : . : . : . : . :
rJMFF030H05- GTCATGAAGGTTATCACCGGGCCTAAGGATACAGAGAGGCAGCAGGTCGAC
JMFF030H05+ GTCATGAAGGTTATCACCGGGCCTAAGGATACAGAGAGGCAGCAGGTCGACAGGGAGAGA
JMFF040L10+ GTCATGAAGGTTATCACCGGGCCTAAGGATACAGAGAGGCAGCAGGTCGACAGGGAGAGA
                      ____________________________________________________________
consensus GTCATGAAGGTTATCACCGGGCCTAAGGATACAGAGAGGCAGCAGGTCGACAGGGAGAGA
 
. : . : . : . : . : . :
JMFF030H05+ AGCTTCACTTTCTTGATGGTATTTGAGATTGGACCATAATAGATGACACCTGTGTCTTTT
JMFF040L10+ AGCTTCACTTTCTTGATGGTATTTGAGATTGGACCATAATAGATGACACCTGTGTCTTTT
                      ____________________________________________________________
consensus AGCTTCACTTTCTTGATGGTATTTGAGATTGGACCATAATAGATGACACCTGTGTCTTTT
 
. : . : . : . : . : . :
JMFF030H05+ TCATCGTTTCCCACATCATTTCCTTTACGAGGTCCAATACTAATCTTGTTATCCTCTTCT
JMFF040L10+ TCATCGTTTCCCACATCATTTCCTTTACGAGGTCCAATACTAATCTTGTTATCCTCTTCT
                      ____________________________________________________________
consensus TCATCGTTTCCCACATCATTTCCTTTACGAGGTCCAATACTAATCTTGTTATCCTCTTCT
 
. : . : . : . : . : . :
JMFF030H05+ GCTGAGATGGATTTAGATAACCATCTCTTCTGGACAGTAGCAAGCTGCCTTGCATAATTG
JMFF040L10+ GCTGAGATGGATTTAGATAACCATCTCTTCTGGACAGTAGCAAGCTGCCTTGCATAATTG
                      ____________________________________________________________
consensus GCTGAGATGGATTTAGATAACCATCTCTTCTGGACAGTAGCAAGCTGCCTTGCATAATTG
 
. : . : . : . : . : . :
JMFF030H05+ CTATCCGTTTTAGCATGCGTATAAGAAAAGGTCCCAGAACTACCCAGATGAAAACCTGAT
JMFF040L10+ CTATCCGTTTTAGCATGCGTATAAGAAAAGGTCCCAGAACTACCCAGATGAAAACCTGAT
                      ____________________________________________________________
consensus CTATCCGTTTTAGCATGCGTATAAGAAAAGGTCCCAGAACTACCCAGATGAAAACCTGAT
 
. : . : . : . : . : . :
JMFF030H05+ CGGAAATAGGTGGAATTGAGACGAGTAGCCTGGGATCGAGCCAAACGAAAGAGCGCTGCA
JMFF040L10+ CGGAAATAGGTGGAATTGAGACGAGTAGCCTGGGATCGAGCCAAACGAAAGAGCGCTGCA
                      ____________________________________________________________
consensus CGGAAATAGGTGGAATTGAGACGAGTAGCCTGGGATCGAGCCAAACGAAAGAGCGCTGCA
 
. : . : . : . : . : . :
JMFF030H05+ GCTCCTGCCATTTTTCCCGAGAGGAATTTGGATTCCGATACTCAATTTTGGT
JMFF040L10+ GCTCCTGCCATTTTTCCCGAGAGGAATTTGGATTCCGATACTCAATTTTGGTAAGCCCTC
                      ____________________________________________________________
consensus GCTCCTGCCATTTTTCCCGAGAGGAATTTGGATTCCGATACTCAATTTTGGTAAGCCCTC