Previous Contig 001735:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040K11Sequence579001735 (3)pir|T03029|T030299e-25omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1694013281 (3)sp|P48620|FD3C_SESIN5e-76Omega-3 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>gb:SIU25817
JMSF002L15Sequence299001735 (3)pir|T03029|T030293e-08omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1665013281 (3)sp|P48620|FD3C_SESIN6e-64Omega-3 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>gb:SIU25817
JMSF040F08Sequence628001735 (3)pir|T03029|T030292e-40omega-3 fatty acid desaturase (EC 1.14.99.-) FAD7 - common tobacco>gb:AB049577_1777013281 (3)sp|P48620|FD3C_SESIN9e-68Omega-3 fatty acid desaturase, chloroplast precursor (EC 1.14.19.-).>gb:SIU25817

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040F08+ AATCCAAACACAGCCACAACATCCCTAACCACATAGCTCATGGACTTCCATGGGTCC
                      ____________________________________________________________
consensus AATCCAAACACAGCCACAACATCCCTAACCACATAGCTCATGGACTTCCATGGGTCC
 
. : . : . : . : . : . :
JMSF040F08+ TTAACCCAGCAATGTTTAGGAATTGCTGCTTTAATGTCAGACAGCTTGAAGGGTGGGGGT
JMFF040K11+ ATTGCTGCTTTAATGTCAGACAGCTTGAAGGGTGGGGGT
                      ____________________________________________________________
consensus TTAACCCAGCAATGTTTAGGAATTGCTGCTTTAATGTCAGACAGCTTGAAGGGTGGGGGT
 
. : . : . : . : . : . :
JMSF040F08+ GCCCCAGGATCAAACCCTTCAACTTCAACTTCTTCTTNTTCATCTTTCCCAATACTCATT
JMFF040K11+ GCCCCAGGATCAAACCCTTCAACTTCAACTTCTTCTTCTTCATCTTTCCCAATACTCATT
                      ____________________________________________________________
consensus GCCCCAGGATCAAACCCTTCAACTTCAACTTCTTCTTCTTCATCTTTCCCAATACTCATT
 
. : . : . : . : . : . :
JMSF040F08+ CCCTCCCTCTCTTCTTCACTCAGCAATGGAGCCCTCACTGGTGCGCTCACCCTCAATGCC
JMFF040K11+ CCCTCCCTCTCTTCTTCACTCAGCAATGGAGCCCTCACTGGTGCGCTCACCCTCAATGCC
                      ____________________________________________________________
consensus CCCTCCCTCTCTTCTTCACTCAGCAATGGAGCCCTCACTGGTGCGCTCACCCTCAATGCC
 
. : . : . : . : . : . :
JMSF040F08+ CAGTTCCTCTCTTTAATCCCCAGCAATGAAAACGAAGAGCCACCAAGATCTGTTCCCAAA
JMSF002L15+ AAAACGAAGAGCCACCAAGATCTGTTCCCAAA
JMFF040K11+ CAGTTCCTCTCTTTAATCCCCAGCAATGAAAACGAAGAGCCACCAAGATCTGTTCCCAAA
                      ____________________________________________________________
consensus CAGTTCCTCTCTTTAATCCCCAGCAATGAAAACGAAGAGCCACCAAGATCTGTTCCCAAA
 
. : . : . : . : . : . :
JMSF040F08+ GCTTTCAGCTTTGGTAAGCTGAGAGAATGGGTAGAAGCTGAAACAGCCCTAGGTTTTGGA
JMSF002L15+ GCTTTCAGCTTTGGTAAGCTGAGAGAATGGGTAGAAGCTGAAACAGCCCTAGGTTTTGGA
JMFF040K11+ GCTTTCAGCTTTGGTAAGCTGAGAGAATGGGTAGAAGCTGAAACAGCCCTAGGTTTTGGA
                      ____________________________________________________________
consensus GCTTTCAGCTTTGGTAAGCTGAGAGAATGGGTAGAAGCTGAAACAGCCCTAGGTTTTGGA
 
. : . : . : . : . : . :
JMSF040F08+ AAGACCCGTGGGAGTGGCCTAACACCACATTCTGATAACACCCAACTCGCCATTACAGTG
JMSF002L15+ AAGACCCGTGGGAGTGGCCTAACACCACATTCTGATAACACCCAACTCGCCATTACAGTG
JMFF040K11+ AAGACCCGTGGGAGTGGCCTAACACCACATTCTGATAACACCCAACTCGCCATTACAGTG
                      ____________________________________________________________
consensus AAGACCCGTGGGAGTGGCCTAACACCACATTCTGATAACACCCAACTCGCCATTACAGTG
 
. : . : . : . : . : . :
JMSF040F08+ CTCCCTCCCAAGACAAAAATCAAGACTTTTTAGGCTTTTAGCTCTGGGTTCTCTAGAACC
JMSF002L15+ CTCCCTCCCAAGACAAAAATCAAGACTTTTTAGGCTTTTAGCTCTGGGTTCTCTAGAACC
JMFF040K11+ CTCCCTCCCAAGACAAAAATCAAGACTTTTTAGGCTTTTAGCTCTGGGTTCTCTAGAACC
                      ____________________________________________________________
consensus CTCCCTCCCAAGACAAAAATCAAGACTTTTTAGGCTTTTAGCTCTGGGTTCTCTAGAACC
 
. : . : . : . : . : . :
JMSF040F08+ AGAGCTTATCAGTCCAAAAACAAATCAAAGATTCTTGAATTGAGAGAGAGAGAGAGAGAG
JMSF002L15+ AGAGCTTATCAGTCCAAAAACAAATCAAAGATTCTTGAATTGAGAGAGAGAGAGAGAGAG
JMFF040K11+ AGAGCTTATCAGTCCAAAAACAAATCAAAGATTCTTGAATTGAGAGAGAGAGAGAGAGAG
                      ____________________________________________________________
consensus AGAGCTTATCAGTCCAAAAACAAATCAAAGATTCTTGAATTGAGAGAGAGAGAGAGAGAG
 
. : . : . : . : . : . :
JMSF040F08+ AGAGGGATGATCCAAGATTTTCTGCTACTCTGCTTTCTCTCACCTACTGCTTCTGTTTAT
JMSF002L15+ AGAGGGATGATCCAAGATTTTCTGCT
JMFF040K11+ AGAGGGATGATCCAAGATTTTCTGCTACTCTGCTTTCTCTCACCTACTGCTTCTGTTTAT
                      ____________________________________________________________
consensus AGAGGGATGATCCAAGATTTTCTGCTACTCTGCTTTCTCTCACCTACTGCTTCTGTTTAT
 
. : . : . : . : . : . :
JMSF040F08+ ATATAAAGGAGACGACAGGAAACATTCCCC
JMFF040K11+ ATATAAAGGAGACGACAGGAAACATTCCCCGCCCTCTTCCTCTCCTTCGCAGGTTAGAAT
                      ____________________________________________________________
consensus ATATAAAGGAGACGACAGGAAACATTCCCCGCCCTCTTCCTCTCCTTCGCAGGTTAGAAT