Previous Contig 001719:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022N06Sequence722001719 (3)gb:AY136387_15818888e-46Arabidopsis thaliana unknown protein (At2g25740) mRNA, complete cds.>gb:BT002106
JMFF040B17Sequence439001719 (3)gb:AP005700_18562861e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN399001719 (3)gb:AP005700_18562861e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022N06+ GCC
                      ____________________________________________________________
consensus GCC
 
. : . : . : . : . : . :
rJMFF022N06+ TCACAGATCCCTGTTGCTGTAGGAGCTTCGGCTTATCAGGCAGTCTGCTTATACAAGGGC
                      ____________________________________________________________
consensus TCACAGATCCCTGTTGCTGTAGGAGCTTCGGCTTATCAGGCAGTCTGCTTATACAAGGGC
 
. : . : . : . : . : . :
rJMFF022N06+ TGGAGGGTAGTCATGTCAAATGGTGAAGTCGCAACAAACTGGAAAGTGCTTCAGCTCGTT
                      ____________________________________________________________
consensus TGGAGGGTAGTCATGTCAAATGGTGAAGTCGCAACAAACTGGAAAGTGCTTCAGCTCGTT
 
. : . : . : . : . : . :
rJMFF022N06+ CTTTACTGTTTCTTCGGGATTTTGGCTGGTGTAGTTGGTGGGTTGCTAGGTCTTGGAGGG
                      ____________________________________________________________
consensus CTTTACTGTTTCTTCGGGATTTTGGCTGGTGTAGTTGGTGGGTTGCTAGGTCTTGGAGGG
 
. : . : . : . : . : . :
rJMFF022N06+ GGATTCATTTTGGGTCCATTATTTCTAGAGCTTGGAATTCCTCCCCAGGTATCAAGTGCC
                      ____________________________________________________________
consensus GGATTCATTTTGGGTCCATTATTTCTAGAGCTTGGAATTCCTCCCCAGGTATCAAGTGCC
 
. : . : . : . : . : . :
rJMFF022N06+ ACTGCCACCTTCATAATGCTGTTTTCGTCATCAATGTCGGTCATACAATACTACCTTCTT
                      ____________________________________________________________
consensus ACTGCCACCTTCATAATGCTGTTTTCGTCATCAATGTCGGTCATACAATACTACCTTCTT
 
. : . : . : . : . : . :
rJMFF022N06+ CACCGTTTCCCCGTACCTTATGCTCTCTATTTCGTTGCGGTGGCTACTATTGCTGCGTTG
                      ____________________________________________________________
consensus CACCGTTTCCCCGTACCTTATGCTCTCTATTTCGTTGCGGTGGCTACTATTGCTGCGTTG
 
. : . : . : . : . : . :
rJMFF022N06+ GTGGGCCAACATGTGGTGCGAAAAATAATTAGTATAGTAGGGAGGGCATCCGTGATCGTC
rJMFF040B17+ GGGCATCCGTGATCGTC
JMFF040B17- GGGCATCCGTGATCGTC
                      ____________________________________________________________
consensus GTGGGCCAACATGTGGTGCGAAAAATAATTAGTATAGTAGGGAGGGCATCCGTGATCGTC
 
. : . : . : . : . : . :
rJMFF022N06+ TTTGTTTTGGCCTTCACGATCTTTCTGAGCGCAATATCATTAGGTGGCGTTGGCATCTTC
rJMFF040B17+ TTTGTTTTGGCCTTCACGATCTTTCTGAGCGCAATATCATTAGGTGGCGTTGGCATCTTC
JMFF040B17- TTTGTTTTGGCCTTCACGATCTTTCTGAGCGCAATATCATTAGGTGGCGTTGGCATCTTC
                      ____________________________________________________________
consensus TTTGTTTTGGCCTTCACGATCTTTCTGAGCGCAATATCATTAGGTGGCGTTGGCATCTTC
 
. : . : . : . : . : . :
rJMFF022N06+ GACACTATTAGGAAGATAGAGGCAGGAGAATATATGGGATTTGTTAACATCTGTGAAACT
rJMFF040B17+ GACACTATTAGGAAGATAGAGGCAGGAGAATATATGGGATTTGTTAACATCTGTGAAACT
JMFF040B17- GACACTATTAGGAAGATAGAGGCAGGAGAATATATGGGATTTGTTAACATCTGTGAAACT
                      ____________________________________________________________
consensus GACACTATTAGGAAGATAGAGGCAGGAGAATATATGGGATTTGTTAACATCTGTGAAACT
 
. : . : . : . : . : . :
rJMFF022N06+ ACTTACTAACACTGCTTCTACAGATTGTTCTTTTCCTCTTTTTGTTCAAGTTACTGTTAA
rJMFF040B17+ ACTTACTAACACTGCTTCTACAGATTGTTCTTTTCCTCTTTTTGTTCAAGTTACTGTTAA
JMFF040B17- ACTTACTAACACTGCTTCTACAGATTGTTCTTTTCCTCTTTTTGTTCAAGTTACTGTTAA
                      ____________________________________________________________
consensus ACTTACTAACACTGCTTCTACAGATTGTTCTTTTCCTCTTTTTGTTCAAGTTACTGTTAA
 
. : . : . : . : . : . :
rJMFF022N06+ TTCCACTGGAGAGAGTTTCTTCTTTATGCTTGTCACTCCTGTAATCTGACATGAAGGCTC
rJMFF040B17+ TTCCACTGGAGAGAGTTTCTTCTTTATGCTTGTCACTCCTGTAATCTGACATGAAGGCTC
JMFF040B17- TTCCACTGGAGAGAGTTTCTTCTTTATGCTTGTCACTCCTGTAATCTGACATGAAGGCTC
                      ____________________________________________________________
consensus TTCCACTGGAGAGAGTTTCTTCTTTATGCTTGTCACTCCTGTAATCTGACATGAAGGCTC
 
. : . : . : . : . : . :
rJMFF022N06+ TGTCCATAAACCATTGTTGTAAAGTTTGCCAGACATACAGTACTCTGAGAGATTCCAAG
rJMFF040B17+ TGTCCATAAACCATTGTTGTAAAGTTTGCCAGACATACAGTACTCTGAGAGATTCCAAGA
JMFF040B17- TGTCCATAAACCATTGTTGTAAAGTTTGCCAGACATACAGTACTCTGAGAGATTCCAAGA
                      ____________________________________________________________
consensus TGTCCATAAACCATTGTTGTAAAGTTTGCCAGACATACAGTACTCTGAGAGATTCCAAGA
 
. : . : . : . : . : . :
rJMFF040B17+ TTTTTTTTTGTAAAAAAAATCTTTCTGGAACATGACCTTTGATCATGGTTCATGTTCTTG
JMFF040B17- TTTTTTTTTGTAAAAAAAATCTTTCTGGAACATGACCTTTGATCATGGTTCATGTTCTTG
                      ____________________________________________________________
consensus TTTTTTTTTGTAAAAAAAATCTTTCTGGAACATGACCTTTGATCATGGTTCATGTTCTTG
 
. : . : . : . : . : . :
rJMFF040B17+ TAAACTATTGGGACTAACTT
JMFF040B17- TAAACTATTGGGACTAACTTTGTCCCTATAATGCTTGTTGGATCAGTTTCAAAAAAAAAA
                      ____________________________________________________________
consensus TAAACTATTGGGACTAACTTTGTCCCTATAATGCTTGTTGGATCAGTTTCAAAAAAAAAA