Previous Contig 001714:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018D13Sequence497001714 (4)pir|T48556|T485565e-13hypothetical protein F14F18.140 - Arabidopsis thaliana>gb:ATF14F18_1548543 Arabi561001714 (4)pir|T48556|T485567e-13hypothetical protein F14F18.140 - Arabidopsis thaliana>gb:ATF14F18_1548543 Arabi
JMFF040A04Sequence582001714 (4)pir|T48556|T485568e-13hypothetical protein F14F18.140 - Arabidopsis thaliana>gb:ATF14F18_1548543 Arabi561001714 (4)pir|T48556|T485567e-13hypothetical protein F14F18.140 - Arabidopsis thaliana>gb:ATF14F18_1548543 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018D13- AACAAGGGAAGGGAGGATGCAGATGGAGAGCTACTATGGGGG
rJMFF040A04+ AACAAGGGAAGGGAGGATGCAGATGGAGAGCTACTATGGGGG
rJMFF018D13+ AACAAGGGAAGGGAGGATGCAGATGGAGAGCTACTATGGGGG
JMFF040A04- AACAAGGGAAGGGAGGATGCAGATGGAGAGCTACTATGGGGG
                      ____________________________________________________________
consensus AACAAGGGAAGGGAGGATGCAGATGGAGAGCTACTATGGGGG
 
. : . : . : . : . : . :
JMFF018D13- AGGGGGTAATGAGGCTGTGGGGCCCCAGAGCATGAAGGATTTGAGAAGCTACAGCACCTC
rJMFF040A04+ AGGGGGTAATGAGGCTGTGGGGCCCCAGAGCATGAAGGATTTGAGAAGCTACAGCACCTC
rJMFF018D13+ AGGGGGTAATGAGGCTGTGGGGCCCCAGAGCATGAAGGATTTGAGAAGCTACAGCACCTC
JMFF040A04- AGGGGGTAATGAGGCTGTGGGGCCCCAGAGCATGAAGGATTTGAGAAGCTACAGCACCTC
                      ____________________________________________________________
consensus AGGGGGTAATGAGGCTGTGGGGCCCCAGAGCATGAAGGATTTGAGAAGCTACAGCACCTC
 
. : . : . : . : . : . :
JMFF018D13- TTATGCTTACACTTCTTCATCCATGGAGGCTGCTCCCCAGTACAATAATAAAGAAGTGAG
rJMFF040A04+ TTATGCTTACACTTCTTCATCCATGGAGGCTGCTCCCCAGTACAATAATAAAGAAGTGAG
rJMFF018D13+ TTATGCTTACACTTCTTCATCCATGGAGGCTGCTCCCCAGTACAATAATAAAGAAGTGAG
JMFF040A04- TTATGCTTACACTTCTTCATCCATGGAGGCTGCTCCCCAGTACAATAATAAAGAAGTGAG
                      ____________________________________________________________
consensus TTATGCTTACACTTCTTCATCCATGGAGGCTGCTCCCCAGTACAATAATAAAGAAGTGAG
 
. : . : . : . : . : . :
JMFF018D13- GATCAAGAAAAGCAAGAGCAGGGTTTCATCCAGCTTTGCTTCGAAAAGCTGGAGCTTTAA
rJMFF040A04+ GATCAAGAAAAGCAAGAGCAGGGTTTCATCCAGCTTTGCTTCGAAAAGCTGGAGCTTTAA
rJMFF018D13+ GATCAAGAAAAGCAAGAGCAGGGTTTCATCCAGCTTTGCTTCGAAAAGCTGGAGCTTTAA
JMFF040A04- GATCAAGAAAAGCAAGAGCAGGGTTTCATCCAGCTTTGCTTCGAAAAGCTGGAGCTTTAA
                      ____________________________________________________________
consensus GATCAAGAAAAGCAAGAGCAGGGTTTCATCCAGCTTTGCTTCGAAAAGCTGGAGCTTTAA
 
. : . : . : . : . : . :
JMFF018D13- TGACCCAGAGATGCAGAGGAAGAAGAGGGTGGTTGGGTACAAGGCTTATGCTGTGGAAGG
rJMFF040A04+ TGACCCAGAGATGCAGAGGAAGAAGAGGGTGGTTGGGTACAAGGCTTATGCTGTGGAAGG
rJMFF018D13+ TGACCCAGAGATGCAGAGGAAGAAGAGGGTGGTTGGGTACAAGGCTTATGCTGTGGAAGG
JMFF040A04- TGACCCAGAGATGCAGAGGAAGAAGAGGGTGGTTGGGTACAAGGCTTATGCTGTGGAAGG
                      ____________________________________________________________
consensus TGACCCAGAGATGCAGAGGAAGAAGAGGGTGGTTGGGTACAAGGCTTATGCTGTGGAAGG
 
. : . : . : . : . : . :
JMFF018D13- GAAGATGAAAGGCTCTTTCAGAAAGAGTTTCAGATGGATCAAGAACACCTGCAGCCATGT
rJMFF040A04+ GAAGATGAAAGGCTCTTTCAGAAAGAGTTTCAGATGGATCAAGAACACCTGCAGCCATGT
rJMFF018D13+ GAAGATGAAAGGCTCTTTCAGAAAGAGTTTCAGATGGATCAAGAACACCTGCAGCCATGT
JMFF040A04- GAAGATGAAAGGCTCTTTCAGAAAGAGTTTCAGATGGATCAAGAACACCTGCAGCCATGT
                      ____________________________________________________________
consensus GAAGATGAAAGGCTCTTTCAGAAAGAGTTTCAGATGGATCAAGAACACCTGCAGCCATGT
 
. : . : . : . : . : . :
JMFF018D13- TGTTCATGGTTGGTGGTGATTGGTGATCATCATCTTCTGTTTCTTTTCTTATACTGCCTT
rJMFF040A04+ TGTTCATGGTTGGTGGTGATTGGTGATCATCATCTTCTGTTTCTTTTCTTATACTGCCTT
rJMFF018D13+ TGTTCATGGTTGGTGGTGATTGGTGATCATCATCTTCTGTTTCTTTTCTTATACTGCCTT
JMFF040A04- TGTTCATGGTTGGTGGTGATTGGTGATCATCATCTTCTGTTTCTTTTCTTATACTGCCTT
                      ____________________________________________________________
consensus TGTTCATGGTTGGTGGTGATTGGTGATCATCATCTTCTGTTTCTTTTCTTATACTGCCTT
 
. : . : . : . : . : . :
JMFF018D13- AAATTCTTCAGTGTTCTTTTCCCCTTTGAGTATCCACTTATGGATCATGAAGATCCCTAA
rJMFF040A04+ AAATTCTTCAGTGTTCTTTTCCCCTTTGAGTATCCACTTATGGATCATGAAGATCCCTAA
rJMFF018D13+ AAATTCTTCAGTGTTCTTTTCCCCTTTGAGTATCCACTTATGGATCATGAAGATCCCTAA
JMFF040A04- AAATTCTTCAGTGTTCTTTTCCCCTTTGAGTATCCACTTATGGATCATGAAGATCCCTAA
                      ____________________________________________________________
consensus AAATTCTTCAGTGTTCTTTTCCCCTTTGAGTATCCACTTATGGATCATGAAGATCCCTAA
 
. : . : . : . : . : . :
JMFF018D13- AAATTGGTGAATCTGCAAATGTAATGTAATGCAGG
rJMFF040A04+ AAATTGGTGAATCTGCAAATGTAATGTAATGCAGGCTGGGTTGAAGTTCTTGGTTTTGAG
rJMFF018D13+ AAATTGGTGAATCTGCAAATGTAATGTAATGCAGGCTGGGTTGAAGTTCTTGGTTTTGAG
JMFF040A04- AAATTGGTGAATCTGCAAATGTAATGTAATGCAGGCTGGGTTGAAGTTCTTGGTTTTGAG
                      ____________________________________________________________
consensus AAATTGGTGAATCTGCAAATGTAATGTAATGCAGGCTGGGTTGAAGTTCTTGGTTTTGAG
 
. : . : . : . : . : . :
rJMFF040A04+ TATAGATCTGCATATGTATATCACACATAAATTATTATA
rJMFF018D13+ TATAGATCTGCATATGTATATCACACATAAATTATTATA
JMFF040A04- TATAGATCTGCATATGTATATCACACATAAATTATTATATGTCATTTCTTGATGTTTTAA
                      ____________________________________________________________
consensus TATAGATCTGCATATGTATATCACACATAAATTATTATATGTCATTTCTTGATGTTTTAA