Previous Contig 001706:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031N08Sequence607001706 (2)737010052 (2)gb:AY035182_15599490.012Arabidopsis thaliana unknown protein (At4g32330) mRNA, complete cds.>gb:AY113894
JMFF039O07Sequence568001706 (2)741010052 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031N08+ TCCTTTCATTAAATGATGTACTCTTTTCAATAGGAGCAGAAGGCTGTTTAGCCCTTGAT
                      ____________________________________________________________
consensus TCCTTTCATTAAATGATGTACTCTTTTCAATAGGAGCAGAAGGCTGTTTAGCCCTTGAT
 
. : . : . : . : . : . :
JMFF031N08+ GCCGAGGTGCCATTTGAAATTACAGAACTGGAAGAAATGTCCTTTCCATCTTTGCCCTTC
                      ____________________________________________________________
consensus GCCGAGGTGCCATTTGAAATTACAGAACTGGAAGAAATGTCCTTTCCATCTTTGCCCTTC
 
. : . : . : . : . : . :
JMFF031N08+ TTTGACCCAGCAACCACAGCATGCTTGGGGTTAGAAAGTTTCACATTTTTGGGCTTGCCA
                      ____________________________________________________________
consensus TTTGACCCAGCAACCACAGCATGCTTGGGGTTAGAAAGTTTCACATTTTTGGGCTTGCCA
 
. : . : . : . : . : . :
JMFF031N08+ GGAGCCTTTTGTAGTTTACCGCTCTTGGACTCTCCAGAAGTTTTAACTTCAGATTCCTTA
JMFF039O07+ TCCAGAAGTTTTAACTTCAGATTCCTTA
                      ____________________________________________________________
consensus GGAGCCTTTTGTAGTTTACCGCTCTTGGACTCTCCAGAAGTTTTAACTTCAGATTCCTTA
 
. : . : . : . : . : . :
JMFF031N08+ GAATCAGCACAAGAATTGCTTTCTAGAGGCACCATTGACTCATGTATGACCTCTTGGACA
JMFF039O07+ GAATCAGCACAAGAATTGCTTTCTAGAGGCACCATTGACTCATGTATGACCTCTTGGACA
                      ____________________________________________________________
consensus GAATCAGCACAAGAATTGCTTTCTAGAGGCACCATTGACTCATGTATGACCTCTTGGACA
 
. : . : . : . : . : . :
JMFF031N08+ GAAGAGTCAATAGCTATATCATCATTCAAATTAACAGCATTCTGAAAATTCCCTTCAGCT
JMFF039O07+ GAAGAGTCAATAGCTATATCATCATTCAAATTAACAGCATTCTGAAAATTCCCTTCAGCT
                      ____________________________________________________________
consensus GAAGAGTCAATAGCTATATCATCATTCAAATTAACAGCATTCTGAAAATTCCCTTCAGCT
 
. : . : . : . : . : . :
JMFF031N08+ TCCTCGATAGTGAAACTTCCATTCAGAACGCCATCAGACTGATCAACAACAATGTCTTCC
JMFF039O07+ TCCTCGATAGTGAAACTTCCATTCAGAACGCCATCAGACTGATCAACAACAATGTCTTCC
                      ____________________________________________________________
consensus TCCTCGATAGTGAAACTTCCATTCAGAACGCCATCAGACTGATCAACAACAATGTCTTCC
 
. : . : . : . : . : . :
JMFF031N08+ CCAACAGCATGAAGTTGTTTGTCAACCCCGTTTTCACATCCCAACCCATTCTCGGCAATG
JMFF039O07+ CCAACAGCATGAAGTTGTTTGTCAACCCCGTTTTCACATCCCAACCCATTCTCGGCAATG
                      ____________________________________________________________
consensus CCAACAGCATGAAGTTGTTTGTCAACCCCGTTTTCACATCCCAACCCATTCTCGGCAATG
 
. : . : . : . : . : . :
JMFF031N08+ CGTTTTTTATCGTTTGCATCCATCATAAACT
JMFF039O07+ CGTTTTTTATCGTTTGCATCCATCATAAACTGAAAGTTGCAAGGTGGCAACCCACTAAAC
                      ____________________________________________________________
consensus CGTTTTTTATCGTTTGCATCCATCATAAACTGAAAGTTGCAAGGTGGCAACCCACTAAAC
 
. : . : . : . : . : . :
JMFF039O07+ TACAAGCCTAAAGAACCATAAATGCTCAGAAATCCATTGAATCAAGCAGGGATCTGAAAG
                      ____________________________________________________________
consensus TACAAGCCTAAAGAACCATAAATGCTCAGAAATCCATTGAATCAAGCAGGGATCTGAAAG
 
. : . : . : . : . : . :
JMFF039O07+ GCCAGAGAGAGAAAGTATTACAGATGGAGAATAATGTTGAAGAAAAATGAAAAATCTGAA
                      ____________________________________________________________
consensus GCCAGAGAGAGAAAGTATTACAGATGGAGAATAATGTTGAAGAAAAATGAAAAATCTGAA
 
. : . : . : . : . : . :
JMFF039O07+ AGCCCAAGAGAGAAATTTGAAATGGGTATCTGTTGTTTTGCTTTCTTTACTGTGATTAAG
                      ____________________________________________________________
consensus AGCCCAAGAGAGAAATTTGAAATGGGTATCTGTTGTTTTGCTTTCTTTACTGTGATTAAG
 
. : . : . : . : . : . :
JMFF039O07+ GGGATTTAAACTGAAAAGCTCCCTCTTTCTCCTTCTGGAATCTGGATTCAACTCAAAATC
                      ____________________________________________________________
consensus GGGATTTAAACTGAAAAGCTCCCTCTTTCTCCTTCTGGAATCTGGATTCAACTCAAAATC