Previous Contig 001702:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039M05Sequence609001702 (3)gb:AP003804_18336115e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ10741013995 (4)gb:AP000603_18204133e-50Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRP15.
JMSF052E10Sequence702001702 (3)sp|Q94CD8|E134_ARATH3e-61Putative glucan endo-1,3-beta-glucosidase 4 precursor (EC 3.2.1.39) ((1->3)-beta907013995 (4)gb:AP000603_18204132e-62Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRP15.
JMSF052P03Sequence703001702 (3)sp|Q94CD8|E134_ARATH2e-62Putative glucan endo-1,3-beta-glucosidase 4 precursor (EC 3.2.1.39) ((1->3)-beta953013995 (4)sp|Q94CD8|E134_ARATH3e-68Putative glucan endo-1,3-beta-glucosidase 4 precursor (EC 3.2.1.39) ((1->3)-beta

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052P03+ ATCAGATTTAACATATTCATAATACGGATAAGCATTTAGCATG
JMSF052E10+ ATCAGATTTAACATATTCATAATACGGATAAGCATTTAGCATG
                      ____________________________________________________________
consensus ATCAGATTTAACATATTCATAATACGGATAAGCATTTAGCATG
 
. : . : . : . : . : . :
JMSF052P03+ TAGTACGAATTCGTGTTCTGCAGAAACTGAAGGATCTGGAAAACAGTGGAGTTCGACGAG
JMSF052E10+ TAGTACGAATTCGTGTTCTGCAGAAACTGAAGGATCTGGAAAACAGTGGAGTTCGACGAG
JMFF039M05+ TTCGACGAG
                      ____________________________________________________________
consensus TAGTACGAATTCGTGTTCTGCAGAAACTGAAGGATCTGGAAAACAGTGGAGTTCGACGAG
 
. : . : . : . : . : . :
JMSF052P03+ AAGTTGAAAGT-GGCTGTGGATGGGGGGAAGATCTTAGCAATTAGGTCGGTCGATTGAGG
JMSF052E10+ AAGTTGAAAGT-GGCTGTGGATGGGGGGAAGATCTTAGCAATTAGGTCGGTCGATTGAGG
JMFF039M05+ AAGTTGAAAGTGGGCTGTGGATGGGGGGAAGATCTTAGCAATTAGGTCGGTCGATTGAGG
                      ____________________________________________________________
consensus AAGTTGAAAGT-GGCTGTGGATGGGGGGAAGATCTTAGCAATTAGGTCGGTCGATTGAGG
 
. : . : . : . : . : . :
JMSF052P03+ TGTCGAGACTTTGACTTGACTATTCAGGTTTGCGGAAACTAAGGCTTTATGTAGGTAATT
JMSF052E10+ TGTCGAGACTTTGACTTGACTATTCAGGTTTGCGGAAACTAAGGCTTTATGTAGGTAATT
JMFF039M05+ TGTCGAGACTTTGACTTGACTATTCAGGTTTGCGGAAACTAAGGCTTTATGTAGGTAATT
                      ____________________________________________________________
consensus TGTCGAGACTTTGACTTGACTATTCAGGTTTGCGGAAACTAAGGCTTTATGTAGGTAATT
 
. : . : . : . : . : . :
JMSF052P03+ CATAGCAGGGACTAGAACGGGTGCAGCATTCGGAATCGAAGTAAGGACTTCACTTCCCAC
JMSF052E10+ CATAGCAGGGACTAGAACGGGTGCAGCATTCGGAATCGAAGTAAGGACTTCACTTCCCAC
JMFF039M05+ CATAGCAGGGACTAGAACGGGTGCAGCATTCGGAATCGAAGTAAGGACTTCACTTCCCAC
                      ____________________________________________________________
consensus CATAGCAGGGACTAGAACGGGTGCAGCATTCGGAATCGAAGTAAGGACTTCACTTCCCAC
 
. : . : . : . : . : . :
JMSF052P03+ CGCAATAGCTGTAATGTTAGTCGATGGTAGATAAGCTGCCACATTCTTGTTTACCCACGC
JMSF052E10+ CGCAATAGCTGTAATGTTAGTCGATGGTAGATAAGCTGCCACATTCTTGTTTACCCACGC
JMFF039M05+ CGCAATAGCTGTAATGTTAGTCGATGGTAGATAAGCTGCCACATTCTTGTTTACCCACGC
                      ____________________________________________________________
consensus CGCAATAGCTGTAATGTTAGTCGATGGTAGATAAGCTGCCACATTCTTGTTTACCCACGC
 
. : . : . : . : . : . :
JMSF052P03+ TGCCGCCTGAGAAGAGGATTGGCCAATACCTAAGACCTCGTTATTTGTGACGCCAACAAT
JMSF052E10+ TGCCGCCTGAGAAGAGGATTGGCCAATACCTAAGACCTCGTTATTTGTGACGCCAACAAT
JMFF039M05+ TGCCGCCTGAGAAGAGGATTGGCCAATACCTAAGACCTCGTTATTTGTGACGCCAACAAT
                      ____________________________________________________________
consensus TGCCGCCTGAGAAGAGGATTGGCCAATACCTAAGACCTCGTTATTTGTGACGCCAACAAT
 
. : . : . : . : . : . :
JMSF052P03+ AACTTCAATCCCGGTGTTCGATAGAGCACTCAGCATATGAGCATCAGCATCAAATAGACG
JMSF052E10+ AACTTCAATCCCGGTGTTCGATAGAGCACTCAGCATATGAGCATCAGCATCAAATAGACG
JMFF039M05+ AACTTCAATCCCGGTGTTCGATAGAGCACTCAGCATATGAGCATCAGCATCAAATAGACG
                      ____________________________________________________________
consensus AACTTCAATCCCGGTGTTCGATAGAGCACTCAGCATATGAGCATCAGCATCAAATAGACG
 
. : . : . : . : . : . :
JMSF052P03+ GACATGCTTTATCTGACGAGCTTTAAGAAGTTCAACCACATCCTTAGCTGACGGTAGGTT
JMSF052E10+ GACATGCTTTATCTGACGAGCTTTAAGAAGTTCAACCACATCCTTAGCTGACGGTAGGTT
JMFF039M05+ GGCATGCTTTATCTGACGAGCTTTAAGAAGTTCAACCACATCCTTAGCTGACGGTAGGTT
                      ____________________________________________________________
consensus GACATGCTTTATCTGACGAGCTTTAAGAAGTTCAACCACATCCTTAGCTGACGGTAGGTT
 
. : . : . : . : . : . :
JMSF052P03+ AGAGACATCGGTGCCAATGTTTATCCCCACAAACGCACCTACGAAATTGGACAATAACCC
JMSF052E10+ AGAGACATCGGTGCCAATGTTTATCCCCAC-AACGCACCTACGAAATTGGACAATAACCC
JMFF039M05+ AGAGACATCGGTGCCAATGTTTATCCCCACAAACGCACCTACGAAATTGGACAATAACCC
                      ____________________________________________________________
consensus AGAGACATCGGTGCCAATGTTTATCCCCACAAACGCACCTACGAAATTGGACAATAACCC
 
. : . : . : . : . : . :
JMSF052P03+ GCATATAAGCAGGGAAATTCCTAGCCATAG
JMSF052E10+ GCATATAAGCAGGGAAATTCCTAGCCATAG
JMFF039M05+ GCATATAAGCAGGGAAATTCCTAGCCATAGCCATAGTTTAAGCATTGTTAGCTGCAGCAA
                      ____________________________________________________________
consensus GCATATAAGCAGGGAAATTCCTAGCCATAGCCATAGTTTAAGCATTGTTAGCTGCAGCAA
 
. : . : . : . : . : . :
JMFF039M05+ AATAATCAATTTCGTTTCTCCTCTATTTAGCGACACCCAGCTGTAGTAGAGAAACAAGGT
                      ____________________________________________________________
consensus AATAATCAATTTCGTTTCTCCTCTATTTAGCGACACCCAGCTGTAGTAGAGAAACAAGGT