Previous Contig 001701:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036C15Sequence570001701 (2)gb:AY366397_16029041e-60Nicotiana tabacum ntp101 (pntp101) mRNA, complete cds.>gb:AY366399_1602906 Nicot689009894 (2)gb:AF049931_17641306e-73Petunia x hybrida PGPS/NH15 (PGPS/NH15) mRNA, partial cds.
JMFF039L05Sequence584001701 (2)gb:AF479568_18035251e-68Petunia x hybrida 1-ascorbate oxidase (p303) gene, complete cds.724009894 (2)gb:AY366397_16029048e-81Nicotiana tabacum ntp101 (pntp101) mRNA, complete cds.>gb:AY366399_1602906 Nicot

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF036C15+ GGGAT
JMFF039L05+ ACTGATAAAAACATTGAATTCATCCGCGGGGGAATCAAACGGGAC
                      ____________________________________________________________
consensus ACTGATAAAAACATTGAATTCATCCGCGGGGGAATCAAACGGGAT
 
. : . : . : . : . : . :
JMFF036C15+ AGGGATGAGTTCACGACTGTGGACATTGATAGGGCCATAGCCACCCGCCGCGCGTTGCAA
JMFF039L05+ CGGGATGAGGTCACGACTGTGGACATTGATAGGGCCATAGCCGCCGGCCGCGCGTTGCAA
                      ____________________________________________________________
consensus CGGGATGAGTTCACGACTGTGGACATTGATAGGGCCATAGCCGCCGGCCGCGCGTTGCAA
 
. : . : . : . : . : . :
JMFF036C15+ GCCGGTGGTGGGGAAGTAGAAATAGGTGCCAATCTGGTCCTTGACTTGCATCTTGTAGGT
JMFF039L05+ GCCGGTGGTGGGGAAGTAGAAATAGGTGCCAATCTGGTCCTTGACTTGCACCTTGTAGGT
                      ____________________________________________________________
consensus GCCGGTGGTGGGGAAGTAGAAATAGGTGCCAATCTGGTCCTTGACTTGCATCTTGTAGGT
 
. : . : . : . : . : . :
JMFF036C15+ GAAGTTGGTTCCGGGCATTATCGGGCACATGGTCCCAATAGTCCCATCAACCCATGAATT
JMFF039L05+ GAAGTTGGTGCCGGGCATGATAGGGCACATGGTCCCAATAGTCCCATCAACCCATGAATT
                      ____________________________________________________________
consensus GAAGTTGGTTCCGGGCATTATCGGGCACATGGTCCCAATAGTCCCATCAACCCATGAATT
 
. : . : . : . : . : . :
JMFF036C15+ CTTCCTCTGTTTGAATGCCGCTCCACGTCAAGAGCAGAGGCTCATCCAGCTCGTTGAAAA
JMFF039L05+ CTTCCTCTG-TTGAATGCCGCTCCACGTCAAGAGCAGAGGCTCATCCAGCTCGTTGAAAA
                      ____________________________________________________________
consensus CTTCCTCTGTTTGAATGCCGCTCCACGTCAAGAGCAGAGGCTCATCCAGCTCGTTGAAAA
 
. : . : . : . : . : . :
JMFF036C15+ CGTTAACAATAATGTTATTATTAGATGTACAATTGATCTTAGGACCTGGGAACTGGCCGT
JMFF039L05+ CGTTAACAATAATGTTGTTGTTGGATGTGCAATTGATCATAGGACCTGGGAACTGGCCAT
                      ____________________________________________________________
consensus CGTTAACAATAATGTTGTTGTTGGATGTGCAATTGATCTTAGGACCTGGGAACTGGCCGT
 
. : . : . : . : . : . :
JMFF036C15+ TGATGAGGATGCCTTGTTGGGGGACGCCCATGGGGGAAATGGTGCCATAGGTCACCTTCC
JMFF039L05+ TAATGAGGATGCCCTGTTGGGGGAAGCCCATGGGAGAAATGGTGCCATAGGTTACCTTCC
                      ____________________________________________________________
consensus TGATGAGGATGCCTTGTTGGGGGACGCCCATGGGGGAAATGGTGCCATAGGTTACCTTCC
 
. : . : . : . : . : . :
JMFF036C15+ AAGTGAAGAA
JMFF039L05+ ACGTGAAGAACAAGTAGGGGTCCTCCGCTATTACGGCGGAGAGACACAGCAAGAGCACCA
                      ____________________________________________________________
consensus ACGTGAAGAACAAGTAGGGGTCCTCCGCTATTACGGCGGAGAGACACAGCAAGAGCACCA
 
. : . : . : . : . : . :
JMFF039L05+ CCGCTGAGGTTGCGCAAGCTCGCCCCATGGCTCCCCCCGGAACCTTCCCTTTATTTATTC
                      ____________________________________________________________
consensus CCGCTGAGGTTGCGCAAGCTCGCCCCATGGCTCCCCCCGGAACCTTCCCTTTATTTATTC
 
. : . : . : . : . : . :
JMFF039L05+ AAGAAGAAGCGCAGATAGAGATGGGGCGTTTTATTCGTCTTCTTCTTGTTGCTAGAGCTT
                      ____________________________________________________________
consensus AAGAAGAAGCGCAGATAGAGATGGGGCGTTTTATTCGTCTTCTTCTTGTTGCTAGAGCTT