Previous Contig 001700:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039L02Sequence401001700 (2)gb:OSJN00260_16975428e-04Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0079F16, complete seque724012841 (6)gb:BT000879_16351344e-47Arabidopsis thaliana clone C105301 unknown protein (At3g63510) mRNA, complete cd
JMSF001I14Sequence432001700 (2)gb:AY072094_15669886e-27Arabidopsis thaliana unknown protein (At5g47970) mRNA, complete cds.>gb:AY096579752012841 (6)gb:BT000879_16351348e-47Arabidopsis thaliana clone C105301 unknown protein (At3g63510) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF001I14+ AGCACAATAGGGTGTTGCTCAGGCCCATATGCCAAGAACCTGTCCAAATTTCCCTCCT
                      ____________________________________________________________
consensus AGCACAATAGGGTGTTGCTCAGGCCCATATGCCAAGAACCTGTCCAAATTTCCCTCCT
 
. : . : . : . : . : . :
JMSF001I14+ GATACACAATTGTTTCTGCAGCAAGCATTTCGGTATAGAGCCATGCATGTTTCGAGATGA
                      ____________________________________________________________
consensus GATACACAATTGTTTCTGCAGCAAGCATTTCGGTATAGAGCCATGCATGTTTCGAGATGA
 
. : . : . : . : . : . :
JMSF001I14+ GCCGGGCCATAGTTCTGTAGTGATTATCTGTCCACTCCATCATCGGAGCAACACTAAACA
JMFF039L02+ GTGATTATCTGTCCACTCCATCATCGGAGCAACACTAAACA
                      ____________________________________________________________
consensus GCCGGGCCATAGTTCTGTAGTGATTATCTGTCCACTCCATCATCGGAGCAACACTAAACA
 
. : . : . : . : . : . :
JMSF001I14+ AAGGAGGAAGATATCGCTCTGCACCCATTACAGATTCTGTATGCAGTTCCTTCTTTTGAT
JMFF039L02+ AAGGAGGAAGATATCGCTCTGCACCCATTACAGATTCTGTATGCAGTTCCTTCTTTTGAT
                      ____________________________________________________________
consensus AAGGAGGAAGATATCGCTCTGCACCCATTACAGATTCTGTATGCAGTTCCTTCTTTTGAT
 
. : . : . : . : . : . :
JMSF001I14+ GGTAAGCGCGCAATTTCTTTGACTTTGTTGAATTTCCATAAAATAAATTCGATGAGAAT
JMFF039L02+ GGTAAGCGCGCAATTTCTTTGACTTTGTTGAATTTCCATAAAANAAATTCGATGAGAATN
                      ____________________________________________________________
consensus GGTAAGCGCGCAATTTCTTTGACTTTGTTGAATTTCCATAAAATAAATTCGATGAGAATN
 
. : . : . : . : . : . :
JMFF039L02+ TGCCATAGTTNTTTAGGATAACAGAATGAAAAGGAGTTAAGGAAGCAAACAAACAAAGCC
                      ____________________________________________________________
consensus TGCCATAGTTNTTTAGGATAACAGAATGAAAAGGAGTTAAGGAAGCAAACAAACAAAGCC
 
. : . : . : . : . : . :
JMFF039L02+ CGGCAGATTTCATCATCCCTCAAGATGCAGTGTAGTCTGCTCTTTGGTGTACATGGACGA
                      ____________________________________________________________
consensus CGGCAGATTTCATCATCCCTCAAGATGCAGTGTAGTCTGCTCTTTGGTGTACATGGACGA
 
. : . : . : . : . : . :
JMFF039L02+ CAAAGAAGACGATGATGTTCGCCTCCGCCGCCTCCCCCGGCGGTTTTCTTAGAGCTTTCG
                      ____________________________________________________________
consensus CAAAGAAGACGATGATGTTCGCCTCCGCCGCCTCCCCCGGCGGTTTTCTTAGAGCTTTCG
 
. : . : . : . : . : . :
JMFF039L02+ AACACCGGATCGAGCAGTGAGGGAGGCGGGCTGCTTTTCTGGATGCCCGTTAAATATAAC
                      ____________________________________________________________
consensus AACACCGGATCGAGCAGTGAGGGAGGCGGGCTGCTTTTCTGGATGCCCGTTAAATATAAC